We narrowed to 3,402 results for: aaas
-
Plasmid#76071Purpose3rd generation lentiviral gRNA plasmid targeting human STK39DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
STK39 gRNA (BRDN0001147207)
Plasmid#76072Purpose3rd generation lentiviral gRNA plasmid targeting human STK39DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKACB gRNA (BRDN0001147109)
Plasmid#75961Purpose3rd generation lentiviral gRNA plasmid targeting human PRKACBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
C8orf44-SGK3 gRNA (BRDN0001147093)
Plasmid#75907Purpose3rd generation lentiviral gRNA plasmid targeting human C8orf44-SGK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
C8orf44-SGK3 gRNA (BRDN0001148559)
Plasmid#75908Purpose3rd generation lentiviral gRNA plasmid targeting human C8orf44-SGK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLK5 gRNA (BRDN0001145831)
Plasmid#75788Purpose3rd generation lentiviral gRNA plasmid targeting human PLK5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2G gRNA (BRDN0001148335)
Plasmid#75740Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2GDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PCK2 gRNA (BRDN0001146925)
Plasmid#78083Purpose3rd generation lentiviral gRNA plasmid targeting human PCK2DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME5 gRNA (BRDN0001147117)
Plasmid#76572Purpose3rd generation lentiviral gRNA plasmid targeting human NME5DepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPN441
Plasmid#137873PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRi; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinFL
Plasmid#187271PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
KAT2A sgRNA1
Plasmid#138185Purpose3rd generation lentiviral gRNA plasmid targeting human KAT2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-GFP-AnillinFL
Plasmid#187272PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsEGFPPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAP3K13 gRNA (BRDN0001145899)
Plasmid#76905Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K13DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSK gRNA (BRDN0001144968)
Plasmid#77766Purpose3rd generation lentiviral gRNA plasmid targeting human CSKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL3-9465
Plasmid#115464PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
EPHA1 gRNA (BRDN0001148678)
Plasmid#75591Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TGFBR1 gRNA (BRDN0001144967)
Plasmid#76646Purpose3rd generation lentiviral gRNA plasmid targeting human TGFBR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DGKG gRNA (BRDN0001147060)
Plasmid#77456Purpose3rd generation lentiviral gRNA plasmid targeting human DGKGDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CRKL gRNA (BRDN0001147790)
Plasmid#77507Purpose3rd generation lentiviral gRNA plasmid targeting human CRKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKG1 gRNA (BRDN0001147664)
Plasmid#77005Purpose3rd generation lentiviral gRNA plasmid targeting human PRKG1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-USP7-sh1
Plasmid#235527PurposeshRNA against human USP7DepositorInsertUSP7 (USP7 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA3
Plasmid#232625PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L_sgRNA2
Plasmid#201601PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L (LUC7L Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shCALM2-2
Plasmid#193700PurposeConstitutive lentiviral expression of CALM2 shRNADepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g3 (BB36)
Plasmid#139454PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g2 (BB35)
Plasmid#139453PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
DCK gRNA (BRDN0001148859)
Plasmid#78057Purpose3rd generation lentiviral gRNA plasmid targeting human DCKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAK1 gRNA (BRDN0001146970)
Plasmid#77935Purpose3rd generation lentiviral gRNA plasmid targeting human AAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAK1 gRNA (BRDN0001149078)
Plasmid#77937Purpose3rd generation lentiviral gRNA plasmid targeting human AAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAK1 gRNA (BRDN0001149114)
Plasmid#77938Purpose3rd generation lentiviral gRNA plasmid targeting human AAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IRAK3 gRNA (BRDN0001146064)
Plasmid#77713Purpose3rd generation lentiviral gRNA plasmid targeting human IRAK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LTK gRNA (BRDN0001148067)
Plasmid#77598Purpose3rd generation lentiviral gRNA plasmid targeting human LTKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKLR gRNA (BRDN0001148918)
Plasmid#77290Purpose3rd generation lentiviral gRNA plasmid targeting human PKLRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BUB1 gRNA (BRDN0001148548)
Plasmid#76771Purpose3rd generation lentiviral gRNA plasmid targeting human BUB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MARK4 gRNA (BRDN0001148083)
Plasmid#76729Purpose3rd generation lentiviral gRNA plasmid targeting human MARK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GRK7 gRNA (BRDN0001147785)
Plasmid#76500Purpose3rd generation lentiviral gRNA plasmid targeting human GRK7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDKL4 gRNA (BRDN0001147188)
Plasmid#76109Purpose3rd generation lentiviral gRNA plasmid targeting human CDKL4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only