We narrowed to 5,264 results for: crispr cas9 expression plasmids
-
Plasmid#183409PurposepiggyBAC-based doxycycline-inducible dCas9-5xSuntag-VP64 CRISPR activation plasmid for enhancer and promoter activation in mammalian cellsDepositorInsertdCas9-5xGCN5-P2A-scFV-sfGFP-VP64-GB1
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterTRE3GAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC18-mini-Tn7T-Lac-dCas9 (Ptac)
Plasmid#105234PurposeTn7 integrating plasmid with S. pasteurianus dCas9 expressed from the Ptac promoter for expression in P. putida and P. fluorescensDepositorInsertS. pasteurianus dCas9
UseCRISPR and Synthetic BiologyTagsHAExpressionBacterialMutationD10A, H599AAvailable SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA
Plasmid#109320PurposePlasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Neurog2 x2)
Plasmid#171100PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Neurog2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova)
Plasmid#85041PurposeThis plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9.DepositorInsertloxP-stop-loxP
UseCRISPRExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-nSpCas9-NG-P2A-EGFP (KAC1164)
Plasmid#185919PurposepCMV and pT7 plasmid encoding human codon optimized ABE8.20m A-to-G base editor with nickase SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABE8.20m-nSpCas9-NG-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9-NG=D10A/L1111R/D1135V/G1218R/E1219F/A1322…PromoterCMV and T7Available SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP64-pU6-sgRNA
Plasmid#158972PurposeVector C encodes pAAV-pMecp2-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: DHS-4D-3)
Plasmid#159664PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting an enhancer of mouse Otx2.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: DHS-4D-2)
Plasmid#159663PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting an enhancer of mouse Otx2.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: DHS-4D-1)
Plasmid#159662PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting an enhancer of mouse Otx2.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: Ascl1-1)
Plasmid#159656PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting mouse Ascl1.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4
Plasmid#83475PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains HphMx4 marker for yeast transformation.DepositorInsertHphMX4
ExpressionYeastAvailable SinceOct. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCbh-ABE8e-nSpCas9(D10A/A61R)[N-term] (CA19)
Plasmid#197510PurposeCbh promoter expression plasmid for N-terminal intein-split AAV construct with N-term of ABE8e-nSpCas9(D10A/A61R) (to be used with SpRY C-term constructs)DepositorInsertAAV-[ITR]-pCBh-BPNLS-TadA8e-nSpCas9(D10A/A61R)[N-term]-NpuN-BPNLS-[ITR]
UseAAV and CRISPRTagsBPNLS and NpuN(intein)-BPNLSMutationABE8e mutations in TadA and nSpRY(D10A/A61R)PromoterCbhAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CR029
Plasmid#234041Purposeexpresses evoCDA1 BE4max base editor in a human T cell optimized lentiviral transfer plasmidDepositorInsertevoCDA1-Cas9(D10A)-P2A-blast
UseLentiviralTagsblastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-NatMx3
Plasmid#83477PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains NatMX3 marker for yeast transformation.DepositorInsertNatMx3
ExpressionYeastAvailable SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-Cas9C
Plasmid#80932PurposeExpresses Cas9C in mammalian cells; derived from pZac2.1 with CASI promoter.DepositorInsertCas9C
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only