We narrowed to 23,621 results for: promoter
-
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free ClLIS1 (M)
Plasmid#182484PurposeYeast integrative plasmid for expressing ERG20(F96W-N127W) (GAL10 promoter) and limonene synthase from Citrus limon (ClLIS1; GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS(M)
LS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free deadFPPS-NES
Plasmid#182492PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and fusion protein deadFPPS-AcNES1 (GAL7 promoter). deadFPPS is ERG20(K197G-K254A), an inactive mutant of ERG20.DepositorInsertsFPPS
deadFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
IL2-mCherry-AH in pmCherryN1
Plasmid#187284PurposeExpress IL2-AH-mCherryDepositorTagsmCherryExpressionMammalianMutationAHPromoterCMVAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
IL2-mCherry-AHA740D, E758K in pmCherryN1
Plasmid#187285PurposeExpress IL2-AH A740D, E758K-mCherryDepositorTagsmCherryExpressionMammalianMutationAH A740D, E758KPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-hFAM3B-HA
Plasmid#180145PurposeCoding sequence of human FAM3B pCS2 with C terminal HA tagDepositorAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRX-C751-E3616S
Plasmid#182844Purposemutation E3616S (GAA/TCA), PCR product coding C-terminal residues 2976-3726 of TRX was inserted into modified pGEX-2T by Nde I-Nsi I sites. Expression in E. coli. by IPTG inductionDepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO Luc Firefly 2xgRNA - spCas9 iRFP670 puro
Plasmid#166134PurposeThis plasmid allows efficient KO of the firefly luciferase gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting firefly luciferase gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
HEpl016
Plasmid#179991PurposepCBh_3xFLAG_NLS_SiCas12i_NLS_pA_pCMV_mCherry_pU6_crRNA_BbsI: vector for encoding a human codon-optimized SiCas12i driven by CBh promoter and tagmCherry driven by CMV promoterDepositorInsertSiCas12i
Tags3xFlagExpressionMammalianAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-hFAM3B-FLAG
Plasmid#180146PurposeCoding sequence of human FAM3B in pCS2 with C terminal FLAG tagDepositorAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_HA-TALE(HD)-Tet1S-NLS-SID4X_2A_EGFP_W3SL
Plasmid#172208PurposeAAV vector expressing an HA-tagged TALE-SID4X transcriptional repressor protein targeting the mouse Tet1S promoter. Synapsin promoter for neuronal expression. C-terminal, self-cleaving EGFP marker.DepositorInsertHA-TALE(HD)-Tet1S-NLS-SID4X_2A_EGFP_W3SL
UseAAV and Mouse Targeting; TaleTagsHA, NLS, and T2A-EGFPExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_HA-TALE(NG)-Tet1FL-NLS-SID4X_2A_EGFP_W3SL
Plasmid#172205PurposeAAV vector expressing an HA-tagged TALE-SID4X transcriptional repressor protein targeting the mouse Tet1FL promoter. Synapsin promoter for neuronal expression. C-terminal, self-cleaving EGFP marker.DepositorInsertHA-TALE(NG)-Tet1FL-SID4X-NLS_2A_EGFP_W3SL
UseAAV and Mouse Targeting; TaleTagsHA, NLS, and T2A-EGFPExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-DEST42-dre4
Plasmid#170440PurposeExpress drosophila dre4 in E.coli expression system. Generated from pDONR-dre4 by Gateway system. Used for custom antibody purification.DepositorInsertdre4 (dre4 Fly)
Tags6xHis and V5ExpressionBacterialMutationDeleted amino acids 1-20PromoterT7Available SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00008
Plasmid#166724PurposesgRNA cloning backboneDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR10
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
KLC1N343S-Myc
Plasmid#166963PurposeExpresses Myc-tagged KLC1 N343S protein in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDB.His.MBP.3C NLRP1 CARD G1467C
Plasmid#164009PurposeBacterial expression vector encoding a HRV 3C-cleavable His-MBP-tagged NLRP1 CARD G1467CDepositorAvailable SinceFeb. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDB.His.MBP.3C NLRP1 UPA-CARD E1461R
Plasmid#164007PurposeBacterial expression vector encoding a HRV 3C-cleavable His-MBP-tagged NLRP1 UPA-CARD (dimer interface mutation)DepositorAvailable SinceFeb. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDB.His.MBP.3C NLRP1 UPA-CARD W1460A
Plasmid#164006PurposeBacterial expression vector encoding a HRV 3C-cleavable His-MBP-tagged NLRP1 UPA-CARD (dimer interface mutation)DepositorAvailable SinceFeb. 14, 2021AvailabilityAcademic Institutions and Nonprofits only