We narrowed to 25,257 results for: promoter
-
Plasmid#223618PurposeLentiviral expression of human CD86 with SmBiT tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only
-
MigR1-AE9a
Plasmid#12433DepositorUseRetroviralTagsHAExpressionMammalianMutationAML-ETO protein with ETO exon 9a.Available SinceJan. 4, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-WT
Plasmid#91978PurposeExpresses FLAG-HA-AGO2 (WT)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-pdh_RiboJ_mCherry_Bba_B0015
Plasmid#107581PurposeB. megaterium DSM319 pdh promoter, mCherry (Bacillus codon optimised) for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertmCherry
UseSynthetic BiologyExpressionBacterialPromoterpdh promoter Bacillus megaterium DSM319Available SinceApril 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionPromoterArabidopsis U6 polymerase III promoterAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHR-SmBiT-CD80
Plasmid#223614PurposeLentiviral expression of human CD80 with SmBiT tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgCTG-CMV-GFP
Plasmid#216734PurposeAAV plasmid containing sgCTG (target sequence: (CUG)6) driven by a U6 promoter and eGFP under the control of the CMV promoter. Used for in vivo experiments.DepositorArticleInsertsgCTG
UseAAV and CRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E 5X C120 c-fos min pro (JDW 1241)
Plasmid#224544PurposeA Gateway compatible 5' entry clone containing 5 TAEL transcription factor binding sites and a minimal c-Fos promoterDepositorInsert5x-C120-c-Fos promoter
UseGateway cloningAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-human U6-sgRNA-EF1Alpha-puro-T2A-BFP
Plasmid#118594PurposeParental vector for the CRISPRa libraries. Expresses an sgRNA from the human U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertsgRNA/Puro-T2A-BFP
UseLentiviralExpressionMammalianPromoterEF1AlphaAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-3XpolyA-3XPC-miniCMV-mCherry-WPRE-insulator
Plasmid#168291Purposeoptimized miniCMV (OminiCMV)DepositorInsertmCherry
ExpressionMammalianPromoterminiCMVAvailable SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a MICA*009-IRES-ZsGreen
Plasmid#114007PurposeInduces expression of human MICA allele 009 cDNADepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
miCBE
Plasmid#205413PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with APOBEC3A and UGI driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpU6__RNA*_pCAG_bpNLS_APOBEC3A(W104A)_XTEN_OgeuIscB*(D61A)_NLS_2xUGI_bGHployA_pCMV_mCherry
ExpressionMammalianMutationD61A+E85R+H369R+S387R+S457RPromoterhU6, CAG, CMVAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPV-TetO-SpCas9-GR-iC-ERiH (CRONUS-Hygro)
Plasmid#100597PurposepiggyBac vector expressing Dual-regulated Cas9 (Hygro resistance)DepositorInsertsCRISPR Cas9 fused with human Glucocorticoid Receptor
mCherry
rtTA-M2
UsePiggybac vectorExpressionMammalianMutationCodon-optimized for human codon usagePromoterDox-inducible TetO promoter and Human EEF1A1 prom…Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
SLX4IP-SFB
Plasmid#247871PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged SLX4IPDepositorInsertSLX4IP (C20orf94 Human)
TagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-dCas9-VPR-pA-3xsgRNA-EF1a-Tet.O-T2A-PuroR-polyA
Plasmid#166693PurposeExpress dCas9-VPR in a doxycyclin-inducable system and 3 sgRNAs targeting the murine Cnga1 promoter. Can be stably integrated into the genome via the PiggyBac Transposon system.DepositorInsertsdCas9-VPR
3x Cnga1 promoter-targeting sgRNAs
UseCRISPRExpressionMammalianPromoterTRE and U6Available SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Pet22b-mEGFP
Plasmid#166439PurposeBacterial expression of 6x His tagged mEGFPDepositorInsertmEGFP
ExpressionBacterialAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-pHSE::Cre-mRuby3
Plasmid#164136PurposeLentiviral construct for building stable cell lines expressing Cre recombinase and mRuby3 in the presence of heat inductionDepositorInsertHSE promoter-Cre-T2A-mRuby3
UseCRISPR, Cre/Lox, Lentiviral, and Synthetic Biolog…ExpressionMammalianPromoterHSE synthetic promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX317-QKI
Plasmid#115441PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Human Myc-XIAP
Plasmid#217627PurposeMammalian expression of Myc tagged XIAPDepositorInsertXIAP (XIAP Human)
ExpressionMammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only