We narrowed to 5,704 results for: KRAS
-
Plasmid#128214Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) Laccase2 Sense
Plasmid#69892PurposeExpresses the Drosophila laccase2 exon 2 circular RNADepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
Human NCKX3 (pcDNA3.1+)
Plasmid#75205PurposeMammalian expression of SLC24A3DepositorAvailable SinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGMF1-D
Plasmid#242205PurposeAtU6-26p::sgRNA scaffold in L1 vector backbone, for subcloning of 1st 20 bp target sequence. For use in dicots.DepositorInsertLevel1 AtU6-26p::sgRNA1 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU6-26pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF2-D
Plasmid#242206PurposeAtU6-26p::sgRNA scaffold in L1 vector backbone, for subcloning of 2nd 20 bp target sequence. For use in dicots.DepositorInsertLevel1 AtU6-26p::sgRNA2 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU6-26pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIRES2_hMela(CT+IL3 mGluR6)
Plasmid#191343PurposeOptogenetic toolDepositorInserthMela(CT+IL3 mGluR6)
TagsIRES_TurboExpressionMammalianAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
FoxFTVC+bpFOG_MRAS-G22V
Plasmid#107521PurposeConstitutive activation of FGF/MAPK pathway by M-Ras-G22V mutantDepositorInsertM-Ras protein
Mutationchanged Glycine 22 to ValinePromoterTVC-specific FoxF enhancer (FoxFTVC+bpFOG)Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH50
Plasmid#128212Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK007
Plasmid#128220Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH72
Plasmid#128221Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH73
Plasmid#128222Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH74
Plasmid#128223Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) ZKSCAN1 MCS-ZKSCAN1 548-847
Plasmid#69902PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in mammalian cellsDepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 Sense
Plasmid#69883PurposeExpresses the Drosophila laccase2 exon 2 circular RNADepositorAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1-THAP11(AA132-313)
Plasmid#37002DepositorInsertTHAP11(AA132-313) (THAP11 Human)
TagsGSTExpressionBacterialMutationAmino acids 132 to 313Available SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP-Rac1(Q61L)
Plasmid#13720DepositorAvailable SinceMarch 28, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_coli_SLK172
Plasmid#224395PurposeFor expression of the type I CBASS system encoded by Escherichia coli SLK172DepositorInsertEcCdnD_4TM
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) ZKSCAN1 MCS-WT Split GFP + Sense IRES
Plasmid#69909PurposeExpresses a GFP circular RNA containing the sense EMCV IRES in mammalian cellsDepositorAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSH124-ssr
Plasmid#198025PurposeExpresses the gene codying for the Ssr recombinase from Pseudomonas putida DOT-T1EDepositorInsertT0 terminator - Ap/Cb resistance cassette
ExpressionBacterialPromoterApR promoterAvailable SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSH824-ssr
Plasmid#198027PurposeExpresses the gene codying for the Ssr recombinase from Pseudomonas putida DOT-T1EDepositorInsertT0 terminator - Apr resistance cassette
ExpressionBacterialPromoterAprR promoterAvailable SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSH424-ssr
Plasmid#198026PurposeExpresses the gene codying for the Ssr recombinase from Pseudomonas putida DOT-T1EDepositorInsertT0 terminator - Sm resistance cassette
ExpressionBacterialPromoterSmR promoterAvailable SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP-Rac1(T17N)
Plasmid#13721DepositorAvailable SinceMarch 28, 2007AvailabilityAcademic Institutions and Nonprofits only -
Fragment1 with TLS2
Plasmid#196983PurposeGateway-compatible gRNA backbone with TLS2 mobility signal. Template for the addition of target sequences to produce 2x graft-mobile gRNA-TLS2.DepositorInsertIntermediate fragment for assembly of gRNA-TLS2 construct
UseGateway-compatible entry vectorAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pK7WGF2::hCas9
Plasmid#46965PurposeExpresses the human codon usage Cas9 nuclease (Mali et al. Science 339, 823-826, 2013) with an N-terminal GFP tag from the 35S promoter in the plant tissueDepositorInserthCas9
UseCRISPR; Plant expressionTagseGFPPromoter35SAvailable SinceAug. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) Laccase2 MCS Exon Vector
Plasmid#69893PurposeExpression plasmid for expressing circular RNAs of a desired sequence in mammalian cellsDepositorAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-CT3G-CERP2-MG-IRES2-mNeonGreen
Plasmid#175508PurposeAll-in-one piggyBac transposon destination vector for mCMV+dox-inducible expression of Mega Gate cloned elements upstream of IRES2-mNeonGreen (CMVe-hEF1a-driven rtTA and puromycin resistance)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianPromoterTRE3G-mCMVAvailable SinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCR1063
Plasmid#111091PurposeExpresses dCas9-KRAB tagged with mCherry: pHR-hEF1a-dCas9-mcherry-KRAB-mPGK-HygDepositorInsertdCas9-KRAB
UseLentiviralTagsmCherryAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
gRNA NIA Null
Plasmid#198728PurposeExpresses two gRNAs targeting Arabidopsis NIA1 gene for knockout. Neither gRNA is fused to a mobility signal and are therefore non-mobile.DepositorInsertAtNIA1 gRNAs
ExpressionPlantPromoterpU6-26, pU6-29Available SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-CT3G-CERP2-MG-IRES2-mTagBFP2
Plasmid#175509PurposeAll-in-one piggyBac transposon destination vector for mCMV+dox-inducible expression of Mega Gate cloned elements upstream of IRES2-mTagBFP2 (CMVe-hEF1a-driven rtTA and puromycin resistance)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianPromoterTRE3G-mCMVAvailable SinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only