We narrowed to 29,073 results for: Tat
-
Plasmid#116824PurposeLentiviral expression of IKBKB__ANK1 fusionDepositorInsertIKBKB__ANK1
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-MAP2K5__IQCH
Plasmid#116826PurposeLentiviral expression of MAP2K5__IQCH fusionDepositorInsertMAP2K5__IQCH
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_CH2charge
Plasmid#105858PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutatnions modify charge of CH2 domain.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3, muatations: Hi…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
xCIAR_pcDNA5/FRT/TO
Plasmid#86504PurposeExpresses inactive control CIAR (xCIAR) in mammalian cells. Used to generate Flp-In stables.DepositorInsertxCIAR (SOS1 Human)
UseFrtExpressionMammalianMutationF929A and T968L in SOScatPromoterCMV (tet operator)Available SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100L-siResist
Plasmid#49854PurposeEncodes human connexin 43 with M100 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100 mutated to Leucine. Contains severa…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-ADAM29 (E111K)
Plasmid#31144DepositorInsertADAM29 (ADAM29 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationGlutamic acid 111 changed to LysineAvailable SinceSept. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSynSRE-Mut-T-Luc
Plasmid#60490PurposeContains a mutant version of the WT pSynSRE-T-Luc reporter plasmid. Four point mutations in the promoter SRE elements abolish SREBP-induced luciferase expression as described by Smith et al., 1988DepositorInsertHMG-CoA synthase promoter (-324/-225) fused to HMG-CoA synthase TATAA (-28/+39) transcription initiator sequence
UseLuciferaseTagsLuciferase reporterExpressionMammalianMutationFour point mutations (G->C or A->C) in the …PromoterPartial HMG-CoA synthase promoter (-324/-225) fus…Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-GFP ASXL1 (p.G646 Wfs *12) 3x FLAG
Plasmid#81021PurposeCancer-associated ASXL1 truncation mutant in retroviral vectorDepositorInsertASXL1 (ASXL1 Human)
Tags3X FLAGExpressionMammalianMutationp.G646 Wfs *12 truncationPromoter5’LTRAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
IL6R PLAK1
Plasmid#161518PurposeExpresses IL6 receptor (full length) in mammalian cells.DepositorInsertInterleukin 6 Receptor (IL6R Human)
UseLentiviralAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 1 tet pLKO puro
Plasmid#162985PurposeTet-inducible shRNA targeting human METTL3 #1DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/D614G
Plasmid#164566PurposeSARS-CoV-2 Spike protein with D614G mutation (S-GSAS-D614G variant)DepositorInsertSpike (S-GSAS-D614G variant)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-RAD50
Plasmid#116784PurposeLentiviral expression of RAD50DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ROR1
Plasmid#116789PurposeLentiviral expression of ROR1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-VLDLR
Plasmid#116802PurposeLentiviral expression of VLDLRDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTCH1
Plasmid#116779PurposeLentiviral expression of PTCH1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF2660
Plasmid#142350PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TBC1D3B
Plasmid#116798PurposeLentiviral expression of TBC1D3BDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-STK11
Plasmid#116794PurposeLentiviral expression of STK11DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-WDR12
Plasmid#116803PurposeLentiviral expression of WDR12DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PPP2R1A
Plasmid#116777PurposeLentiviral expression of PPP2R1ADepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
DENV4 Rluc Reporter GND mutant Replicon
Plasmid#118586PurposeFor use as a positive control for translation of the Rluc gene in the transfected cells and negative control for replication.DepositorInsertDENV4 Renilla luciferase gene (Rluc) reporter replicon containing replication-defective GND mutation in the NS5 polymerase gene.
UseYeast-e. col shuttle vector prs424MutationThe conserved GDD in the NS5 polymerase gene muta…Available SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Synaptophysin-TdTomato-IRES2-OHT-Cre
Plasmid#134308PurposeExpresses Synaptophysin-TdTomato and also tamoxifen dependant Cre (OHT-Cre, aka Cre-ER)DepositorAvailable SinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TBC1D3B-R162*
Plasmid#116693PurposeLentiviral expression of TBC1D3B R162*DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Mfn2-HA S27A
Plasmid#139193PurposeExpresses C-terminal HA tagged human Mfn2 S27A in mammalian cellsDepositorInsertMFN2 (MFN2 Human)
Tags3HAExpressionMammalianMutationSerine 27 to AlaninePromoterCMV promoterAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-SIRPB1
Plasmid#116790PurposeLentiviral expression of SIRPB1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-SMAD4
Plasmid#116791PurposeLentiviral expression of SMAD4DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET15-ZmPYK
Plasmid#220230PurposeInducible expression of Zymomonas mobilis pyruvate kinaseDepositorTags6xHis-TEVExpressionBacterialPromoterT7Available SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Mfn2-HA S27D
Plasmid#139194PurposeExpresses C-terminal HA tagged human Mfn2 S27D in mammalian cellsDepositorInsertMFN2 (MFN2 Human)
Tags2HAExpressionMammalianMutationSerine 27 to Aspartic AcidPromoterCMV promoterAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-XL4 ASXL1 (p.G646 Wfs *12) 3x FLAG
Plasmid#74245PurposeCancer-associated ASXL1 truncation mutant in mammalian expression vectorDepositorInsertASXL1 (ASXL1 Human)
Tags3X FLAGExpressionMammalianMutationp.G646 Wfs *12 truncationPromoterCMVAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-OXA1L
Plasmid#116768PurposeLentiviral expression of OXA1LDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRepair-SGFP2-CTNNB1
Plasmid#153430PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with SGFP2DepositorInsertCTNNB1 homology arms and mTurquoise2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsSGFP2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-ATG
Plasmid#153429PurposeExpresses a gRNA that overlaps the startcodon of human CTNNB1DepositorAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-MRPS31
Plasmid#116764PurposeLentiviral expression of MRPS31DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-STK11-G56W
Plasmid#116687PurposeLentiviral expression of STK11 G56WDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-GFP ASXL1 (1-479) 3x FLAG
Plasmid#81023PurposeCancer-associated ASXL1 truncation mutant in retroviral vectorDepositorInsertASXL1 (ASXL1 Human)
Tags3X FLAGExpressionMammalianMutationContains ASXL1 amino acids 1-479Promoter5’LTRAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-RCAN2
Plasmid#116786PurposeLentiviral expression of RCAN2DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-S45
Plasmid#164587PurposeExpresses a gRNA that overlaps the S45 codon of human CTNNB1DepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-STK19
Plasmid#116795PurposeLentiviral expression of STK19DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-STK33
Plasmid#116797PurposeLentiviral expression of STK33DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only