We narrowed to 13,072 results for: BASE;
-
Plasmid#100710PurposeB52 plasmid expressing FANCM sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting FANCM (cloned using BbsI) (FANCM Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP311-pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113688PurposeSaCas9 driven by EFS. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTF-ACE2s
Plasmid#162786PurposeThe extracellular domain of Angiotensin converting enzyme 2 (ACE2) expressionDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
Tags10xHis, FLAG, and hTPA leaderExpressionMammalianPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262m
Plasmid#161522PurposeGateway entry clone (attL1 & attR5) for CRISPR-zSpCas9 ABE7.10 mediated A-G base editingDepositorInsertTadA(wt)-TadA(7.10)-zSpCas9(D10A)
UseCRISPR; Gateway compatible tada(wt)-tada(7.10)-zs…ExpressionPlantAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRESneo-MPG(N169D)
Plasmid#23259DepositorAvailable SinceMarch 31, 2010AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Orf10
Plasmid#156486PurposeBacterial expression of Sars-CoV2 Orf10 protein with His-tag and GST-tagDepositorInsertOrf10 (ORF10 Severe acute respiratory syndrome coronavirus 2, Synthetic)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
ACTB-(A)3x
Plasmid#112057PurposeACTB mRNA tagged with 3 copies of Riboglow (variant A)DepositorInsertACTB (ACTB Human)
TagsRiboglow RNA tagExpressionMammalianMutation3 copies of Riboglow tag (variant A) after stop c…PromoterCMVAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
ACTB-(A)2x
Plasmid#112056PurposeACTB mRNA tagged with 2 copies of Riboglow (variant A)DepositorInsertACTB (ACTB Human)
TagsRiboglow RNA tagExpressionMammalianMutation2 copies of Riboglow tag (variant A) after stop c…PromoterCMVAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC-elav1.8kb-TALE1-VP64-P10
Plasmid#104609PurposeExpresses TALE1 under the control of a 1.8kb elav enhancer elementDepositorAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMS04 [myo-3p::bPGC::SL2::mCherry]
Plasmid#168172PurposeExpression of bPGC in BWMs of C. elegansDepositorInsertbPGC
ExpressionWormAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
KK701: pMAGIC (L3-L2) 3x HA eptitope tag + polyA; hU6::xCas9(3.7) gRNA scaffold
Plasmid#121842PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven xCas9(3.7) gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Sox2 HMEJ donor
Plasmid#97322PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Sox2. AAV backbone.DepositorInsertSox2 HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS1830 All-in-one AAV-U1a-NmeABE-8e-2xBPSV40-U6-Fah
Plasmid#199263PurposeSingle AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting the point mutation in the mouse Fah gene of a HT1 mouse modelDepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianPromoterU1aAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-MbCas12a crRNA-BsmBI cassette (BPK4449)
Plasmid#114088PurposeU6 promoter crRNA entry vector used for all MbCas12a crRNAs (clone spacer oligos into BsmBI cassette)DepositorInsertentry vector for MbCas12a crRNAs
ExpressionMammalianAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hMbCas12a-NLS(nucleoplasmin)-3xHA (AAS2134)
Plasmid#114090PurposeCAG promoter expression plasmid for human codon optimized MbCas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized MbCas12a
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-Puro
Plasmid#110851PurposeLentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC-mhc2.4kb-TALE3-VP64-P10
Plasmid#104611PurposeExpresses TALE3 under the control of a 2.4kb mhc enhancer elementDepositorAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H150
Plasmid#170345Purpose6xHis_mT2Del_EPACdDEPCD_Q270E_cp174Cit biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsert6xHis_mT2Del_EPACdDEPCD_Q270E_cp174Cit (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-pro-siRNA-V2-LMNA
Plasmid#111088PurposepET-pro-siRNA-V2 based plasmid for production of recombinant siRNAs (pro-siRNAs) against human Lamin A/C gene.DepositorInsertLamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only