We narrowed to 19,276 results for: Tat
-
Plasmid#156521PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertSCN4B (SCN4B Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD47-Fc(DAPA)-AviTag-6xHis
Plasmid#156502PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertCD47 (CD47 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CEACAM4-Fc(DAPA)-AviTag-6xHis
Plasmid#156496PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertCEACAM4 (CEACAM4 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-RELT-Fc(DAPA)-AviTag-6xHis
Plasmid#156528PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertRELT (RELT Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 KBTBD4 P311PP
Plasmid#184628PurposeMammalian expression vector with N-terminal 3xFlag for KBTBD4 P311PP expression in mammalian cellsDepositorInsertN-terminal 3xFlag tagged KBTBD4 P311PP (KBTBD4 Human)
ExpressionMammalianMutationP311PPPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AtTAS1c-D2-B/c
Plasmid#137883PurposeGateway-compatible entry vector for direct cloning of synthetic trans-acting siRNAs into Arabidopsis thaliana TAS1c precursor at position downstream 3'D1[+]DepositorInsertAtTAS1c-D2-B/c
UseGateway-compatible entry cloneMutationA. thaliana TAS1c precursor sequence including a …Available SinceMay 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-BirA(R118G)-NES-YFP
Plasmid#127363PurposeBinary vector for expressing cytosolic BirA* (R118G)-YFP under the UBQ10 promoter in plantsDepositorInsertBirA* (R118G mutant)
TagsGS linker, NES, V5, and YFPExpressionPlantMutationR118GPromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-UBXD5-Strep-HA
Plasmid#113493PurposeExpression of human UBXD5 with C-terminal strep-HA tagDepositorInsertUBXD5 (UBXN11 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-AIRAPL-Strep-HA
Plasmid#113489PurposeExpression of human AIRAPL with C-terminal strep-HA tagDepositorInsertAIRAPL (ZFAND2B Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{ChETA}on-WPRE
Plasmid#111388PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)DepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
PDGFRB gRNA (BRDN0001147806)
Plasmid#77059Purpose3rd generation lentiviral gRNA plasmid targeting human PDGFRBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO NET1A-V5 WT
Plasmid#69828PurposeExpresses NET1A-V5 in mammalian cells in a doxycycline inducible mannerDepositorInsertNeuroepithelial cell-transforming gene 1 protein A (NET1 Human)
UseLentiviralTagsv5ExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
RCAS(A) human p110 alpha E545K
Plasmid#52211Purposeexpresses human p110 alpha with E545K mutation in avian cellsDepositorAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET3a pro-hRegIIIa
Plasmid#64935Purposebacterial expression of full length human RegIIIalphaDepositorInsertRegIIIa (REG3A Human)
ExpressionBacterialMutationmutations made in 5' end to relax secondary …PromoterT7Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST26 Ago2 5A
Plasmid#60651PurposeExpresses 6xHis-Ago2 (N-termi tag) mutated five serines to alanines in mammalian cellsDepositorInsertArgonaute 2 (AGO2 Human)
Tags6xHis (N-termi tag)ExpressionMammalianMutationmutated five serines to alaninesPromoterCMVAvailable SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-N1-PDZ2-GAGA
Plasmid#32857DepositorInsertsolute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 (SLC9A3R1 Rabbit)
TagsHis,S-tagExpressionMammalianMutationPDZ2 P(161)NGYGF mutated to H(161)NGAGAPromotercmvAvailable SinceFeb. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
FR_HNF1B_P328L329del
Plasmid#31102DepositorInsertHNF1B (HNF1B Human)
UseFlp/frtTagsmycExpressionMammalianMutationmutation P328L329delCCTCTAvailable SinceOct. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
FR_HNF1B_A263insGG
Plasmid#31103DepositorAvailable SinceOct. 17, 2011AvailabilityAcademic Institutions and Nonprofits only