We narrowed to 35,804 results for: lat
-
Plasmid#19977DepositorPublicationInsertGfaABC1D-tTA (GFAP Human, E.coli)
ExpressionMammalianAvailable sinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDESTmycEIF2C1
Plasmid#19871DepositorAvailable sinceDec. 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-AKAP79-AKAR4
Plasmid#181957PurposeGenetically encoded FRET-based PKA activity reporter fused to AKAP79.DepositorInsertAKAP79-AKAR4 (AKAP5 Human)
TagsAKAP79, Cerulean, HIS tag, and cpVenus(E172)ExpressionMammalianPromoterCMVAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
GST PTBP1 isoform 4
Plasmid#108594PurposeRecombinant GST tagged protein productionDepositorInsertPTBP1 isoform 4 (PTBP1 Human)
TagsGSTExpressionBacterialMutationisoform 4 (isoform a)PromotertacAvailable sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p70a-UTR3-deGFP-6xHis-T500
Plasmid#92224PurposeExpression of deGFP using the p70a promoter and UTR3DepositorInsertdeGFP
UseSynthetic Biology; Cell free protein synthesis (c…Tags6xHisExpressionBacterialPromoterp70aAvailable sinceJune 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
MPL-bio-His
Plasmid#53339PurposeExpresses full-length Thrombopoietin receptor precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertNM_005373.2 (MPL Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
SERA9-bio-His
Plasmid#50820PurposeExpresses enzymatically monobiotinylated full length SERA9DepositorInsertSERA9
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable sinceFeb. 12, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLIK-NFLAG-hEWSR1P552L-CMyc
Plasmid#50736PurposeProduces lentivirus expressing human EWSR1P552L mutant with FLAG tag at its N-terminus and Myc tag at its C-terminus by co-transfection with psPAX2 and pMD2GDepositorInsertEWSR1 P552L (EWSR1 Human)
UseLentiviralTagsFLAG and MycMutationChanged Pro 552 to LeuPromoterTREAvailable sinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-con/fon DREADD Gq-mCherry
Plasmid#200661PurposeConstruct for chemogenetically activating and visualizing subpopulations of neurons in the retinaDepositorInsertDREADD Gq-mCherry
UseAAV, Cre/Lox, and Mouse Targeting ; IntrsectTagsmCherryExpressionMammalianPromoterhSynAvailable sinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
BB44_pmc.DonorR5.TS
Plasmid#199223PurposeDonor plasmid with CCR5 target sites for ITPN or HMEJ knock-in at the human CCR5 safe harbour locusDepositorInsertExpression unit for mCherry - monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
dTAG-IRF8
Plasmid#190620PurposeLentiviral expression plasmid of human IRF8 fused with FKBP12G36V for dTAG-mediated degradationDepositorInsertIRF8 (IRF8 Human)
UseLentiviralTagsFKBP12_G36VExpressionMammalianMutationsynonymous mutation for sgRNA resistance for sgIR…Available sinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-BDNF-pHluorin
Plasmid#187193PurposeTo express the mouse BDNF tagged with the FP pHluorinDepositorInsertBDNF (Bdnf Mouse)
UseLentiviralTagspPHluorinExpressionMammalianMutationThe codon were optimized for better expressionPromoterCMVAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
ZMYND8-dTAG
Plasmid#190617PurposeLentiviral expression plasmid of human ZMYND8 fused with FKBP12G36V for dTAG-mediated degradationDepositorInsertZMYND8 (ZMYND8 Human)
UseLentiviralTagsFKBP12_G36V and Flag, 2xHAExpressionMammalianMutationsynonymous mutation for sgRNA resistance at aa214…Available sinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-PD-1 (Y223F, Y248F)-mGFP
Plasmid#180790PurposeExpression of human PD-1 (Y223F, Y248F) fused to mEGFPDepositorInsertPD-1 (Y223F, Y248F) (PDCD1 Human)
UseLentiviralTagsmEGFPMutationPD-1 (Y223F, Y248F)PromoterSFFVAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; HE1A:BFP -2
Plasmid#180009PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; HE1A: BFP
UseSynthetic BiologyAvailable sinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-NES
Plasmid#171006PurposeHiLITR protease with C-terminal NNES (Cytoplasmic)DepositorInsertEGFP-uTEV1-NES
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIG2-Flag-mNuak1 WT
Plasmid#168507PurposeFor expression of Nuak1 (AMPK-related kinase also called ARK5/Omphk1)DepositorAvailable sinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.RBBP4
Plasmid#125164PurposeExpresses human RBBP4 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorInsertHistone-binding protein RBBP4 (RBBP4 Human)
TagsHis-MBPExpressionInsectPromoterPolyhedrinAvailable sinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFB1.HMBP.PrS.EZH2
Plasmid#125161PurposeExpresses human EZH2 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable sinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by