We narrowed to 8,705 results for: set
-
Plasmid#137165PurposeIntersectional viral expression of GCaMP6M in cells expressing Cre AND Flp AND VcreDepositorInsert3x-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEf1aAvailable SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_PP7-tag
Plasmid#73078Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with PP7-tag on 5'-endDepositorInsertE2F7 (E2F7 Human)
Tags5'-PP7-tag RNAExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by intronsAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEM-NLS-BirA-2A-mCherry-SV40pA-FKF
Plasmid#79889PurposeDonor cassette containing HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), mCherry protein and SV40 polyA tail, followed by FRT site-flanked Kanamycin selection geneDepositorInsertHA-tagged NLS-BirA, 2A, mCherry protein and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
ExpressionBacterialAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM BirA-2A-Citrine-SV40pA-FRT-Kan-FRT
Plasmid#89890PurposeBAC donor construct containing 3XHA-tagged BirA, a ribosome skipping motif - 2A, Citrine reporter, polyadenyation signal, followed by FRT recombination sites flanking kanamycin selection cassette.DepositorInsertHA-BirA-2A-citrine
UseUnspecifiedTagsCitrineAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT1-His-H2B-Cherry-2A (IG156)
Plasmid#99622PurposeTo clone gene of interest downstream of FRT1-His-H2B-Cherry-2A cassetteDepositorInsertHis-H2B-Cherry
ExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mc4r->M71-IRES-tauGFP ACNF TV
Plasmid#105072PurposeTargeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-333 of Mc4r and an IRES-tauGFP followed by ACNF cassetteDepositorInsertMc4r->M71-IRES-tauGFP-ACNF (Mc4r Mouse)
UseMouse TargetingAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_2ntmut
Plasmid#73074Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with mutated snord27 binding siteDepositorInsertE2F7 (E2F7 Human)
ExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by introns, 2…Available SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsynapsin-DIO-scramble shRNA - mCherry
Plasmid#245064PurposeAAV transgene designes to express scramble (control) shRNA sequence cell-type selectively. Scramble hairpin expressed from the mir30 cassette together with mCherry.DepositorInsertAAV-DIO-scramble-shRNA-mCherry
UseAAV, Cre/Lox, and RNAiTagsmCherryExpressionMammalianPromoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-Af1521(K35E/Y145R)-myc
Plasmid#196237PurposeAf1521(K35E/Y145R) macrodomain with a myc tag fused to the C terminus & a hygromycin resistance cassetteDepositorInsertAf1521(K35E/Y145R) encoding a C-terminal myc tag
UseLentiviralTagsmyc tagExpressionMammalianMutationamino acid 35 lysine is replaced with glutamic ac…PromoterEF1AAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TNT4-Zfr-P2A-HA-luciferase
Plasmid#223188PurposePlasmid containing the Zfr/Firefly luciferase cassette. Translation of luciferase is controlled by splicing modulation of the Zfr by risdiplam.DepositorAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA1
Plasmid#232623PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA2
Plasmid#232624PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA3
Plasmid#232625PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-Luciferase-P2A-H2A-mCherry (JDW 1129)
Plasmid#229823PurposeA CAGGS driven luciferase reporter followed by a P2A cleavage peptide and an H2A mCherry cassette for nuclear labeling.DepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-KO-Puro-TP53
Plasmid#227319PurposeDonor template for 2A-Puro insertion into the N-terminus of the TP53 locus. For selectable p53 knock-out. To be co-transfected with sgRNA plasmid px330-TP53 (Addgene #227318)DepositorInsertTP53 Homology Arms flanking a 2A-Puro Cassette (TP53 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Puro-CEP192
Plasmid#227290PurposeDonor template for mStayGold-EFS-Puro insertion into the C-term of CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold-EFS-Puro Cassette (CEP192 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-LexA-mODC-LexOP-35SCaMV (JDW 1348)
Plasmid#224505PurposeGateway compatible middle entry clone containing a Destablized LexA and LexOperon with minimal CaMV 35S promoter as an all in one casette for RU486 driven gene expressionDepositorInsertLexA-mODC-LexOP-35SCaMV
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-lox-3xNLS-mCherry-V5-SV40pA-3xstop-lox (JDW 1232)
Plasmid#224522PurposeA Gateway compatible middle entry clone containing loxP flanked 3xNLS-mCherry-V5-3xSTOP cassetteDepositorInsertlox-3xNLS-mCherry-V5-SV40pA-3xstop-lox
UseCre/LoxAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only