We narrowed to 29,073 results for: Tat
-
Plasmid#153431PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with mScarlet-iDepositorInsertCTNNB1 homology arms and mScI coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsmScarlet-iAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PRKD1
Plasmid#116778PurposeLentiviral expression of PRKD1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-STK31
Plasmid#116796PurposeLentiviral expression of STK31DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRepair-SYFP2-CTNNB1
Plasmid#153432PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with SYFP2DepositorInsertCTNNB1 homology arms and SYFP2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsSYFP2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-D2512H
Plasmid#69017Purposeactivating MTOR mutationDepositorInsertMTOR-D2512H (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Aspartate 2512 to HistidineAvailable SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-WDR12-S127F
Plasmid#116707PurposeLentiviral expression of WDR12 S127FDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ROR1-T69M
Plasmid#116675PurposeLentiviral expression of ROR1 T69MDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX462-ABE8e-nSaCas9-Intergenic sgRNA
Plasmid#237465PurposeAll-in-one base editor expressing adenine base editor (ABE8e-nSaCas9) and sgRNA control targeting Intergenic siteDepositorInsertIntergenic sgRNA
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJL388
Plasmid#243717PurposeStably expresses a Myc-tagged AKAP1 with a GDDG mutation and gRNA-resistant silent mutationsDepositorInsertAKAP1 (AKAP1 Human)
UseLentiviralTagsMycMutationGXXG motif (GKQG 624-627) mutated to GDDG, and gR…Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+) PCMT1 H58 A214
Plasmid#246496PurposeRecombinant protein expression of PCMT1 H58 A214DepositorInsertProtein-L-isoaspartate(D-aspartate) O-methyltransferase 1 (PCMT1 Human)
TagsHis-tagExpressionBacterialMutationThreonine 58 mutated to Histidine and Valine 214 …PromoterT7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-shAtg7-mCherry-CAAX
Plasmid#227687PurposeMembrane tethered mCherry and shRNA targeting Atg7DepositorInsertAtg7 shRNA (Atg7 Mouse)
ExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-PDE6B-146
Plasmid#239098PurposepGL3 luciferase vector with 146bp PDE6B promoter (containing NRL response element).DepositorArticleInsertPDE6B promoter (PDE6B Human)
UseLuciferaseAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGECPL.BC10.MG
Plasmid#223822PurposeContains Cas9-editable barcode, marking guide (MG) for lineage tracing, Cre for Cas9 activation and loxP-mediated gene deletion, and Firefly Luciferase (FLuc) for live luminescence-based monitoring.DepositorInsertEf1a-Driven Cre-P2A-FLuc
UseCRISPR, Cre/Lox, Lentiviral, Luciferase, and Mous…TagsP2AExpressionMammalianPromoterEf1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFlare9A-Clip2E9 Mutant
Plasmid#209575Purposeminigene construct for Clip2 E9 alternative splicing, potential PTBP2 binding sites are deletedDepositorInsertClip2 (Clip2 Mouse)
ExpressionMammalianMutationACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTG…PromoterCMVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cas9_ANKRD1_sgRNA2
Plasmid#186669PurposePlasmid containing Cas9 and ANKRD1 sgRNA2 , sgRNA sequence: cggtcagcttatatagct.DepositorInsertANKRD1 KO sgRNA Plasmid (ANKRD1 Human)
ExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQE30-VRN1-R249E-R289E-R296E
Plasmid#159532PurposeExpresses Arabidopsis thaliana VERNALIZATION1 mutant, with R249E, R289E and R296E mutations, in E. coliDepositorInsertVERNALIZATION1 (VRN1 Mustard Weed)
TagsSix-Histidine tagExpressionBacterialMutationThree charge reversal mutations, namely R249E R28…PromoterT5Available SinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA3
Plasmid#160213PurposeKnock Down MYDSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA3 targeting collybistin MYD-CBSH3- isoforms (Plasmid #160212)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationTGTATGACCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRepair-mTq2-CTNNB1
Plasmid#153433PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with mTurquoise2DepositorInsertCTNNB1 homology arms and mTurquoise2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsmTurquoise2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTH2-L22V
Plasmid#116639PurposeLentiviral expression of PTH2 L22VDepositorAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTH2
Plasmid#116781PurposeLentiviral expression of PTH2DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL
Plasmid#116766PurposeLentiviral expression of NOTCH2NLDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TBC1D3B-R162Q
Plasmid#116694PurposeLentiviral expression of TBC1D3B R162QDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-WDR12-Q93K
Plasmid#116706PurposeLentiviral expression of WDR12 Q93KDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TBC1D3B-G164E
Plasmid#116692PurposeLentiviral expression of TBC1D3B G164EDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL-G137L
Plasmid#116439PurposeLentiviral expression of NOTCH2NL G137LDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL-Q172_G173delinsHC
Plasmid#116440PurposeLentiviral expression of NOTCH2NL Q172_G173delinsHCDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL-R87M
Plasmid#116441PurposeLentiviral expression of NOTCH2NL R87MDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL-S165F
Plasmid#116442PurposeLentiviral expression of NOTCH2NL S165FDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-OXA1L-L57F
Plasmid#116445PurposeLentiviral expression of OXA1L L57FDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-OXA1L-P58S
Plasmid#116446PurposeLentiviral expression of OXA1L P58SDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP V107M-L273D-L276D
Plasmid#114183PurposeORAI1 channel with C-terminal YFP, carrying the constitutively activating mutation V107M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP V107M-L273D-L276D (ORAI1 Human)
TagsYFPExpressionMammalianMutationV107M/L273D/L276DAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP T184M-L273D-L276D
Plasmid#114184PurposeORAI1 channel with C-terminal YFP, carrying the activating mutation T184M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP T184M-L273D-L276D (ORAI1 Human)
TagsYFPExpressionMammalianMutationT184M/L273D/L276DAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_VPEVS
Plasmid#105863PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_ILGGP
Plasmid#105855PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2charge
Plasmid#105852PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutations modify charge of CH2 domain.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1, muatations: Gl…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100/125/147L-siResist
Plasmid#49856PurposeEncodes human connexin 43 with M100, M125, and M147 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100, Methionine 125, and Methionine 147…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100/125L-siResist
Plasmid#49855PurposeEncodes human connexin 43 with M100 and M125 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100 and Methionine 125 mutated to Leuci…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TGFBR2
Plasmid#116800PurposeLentiviral expression of TGFBR2DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only