We narrowed to 41,620 results for: Eras
-
Plasmid#26404DepositorAvailable SinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits only
-
pv9_CBX7_Chromo/TAF3.PHD-13XL-BASU
Plasmid#179415PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of CBX7.Chromo/TAF3.PHD-13XL-BASUDepositorInsertCBX7.Chromo/TAF3.PHD-13XL-BASU
ExpressionMammalianPromoterCAGGSAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_Q62C-A140C
Plasmid#162581PurposeExpresses norovirus GI.1 VP1 protein with mutations Q62C-A140C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlutamine 62 changed to Cysteine and Alanine 140 …PromoterpolyhedringAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC
Plasmid#98661PurposeExpresses MBP-tagged hnRNPA2 AA 190-341DepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
KRAS-P34R
Plasmid#158527PurposeExpresses human KRAS P34R in E. coli with amino terminal 6xHIS tag that can be removed with TEV protease.DepositorInsertKRAS (KRAS Human)
Tags6xHis-tag and TEV protease cleavage sequenceExpressionBacterialPromoterT5Available SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HOXB13_#2
Plasmid#70094PurposeExpression of shRNA to human HOXB13, puromycin selectionDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Granulin 2+linker3
Plasmid#176920Purposeexpress Granulin 2 with linker 3 in mammalian cellsDepositorInsertGranulin 2+linker3 (GRN Human)
TagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
CIBN-rTetR
Plasmid#183919PurposeOptogenetic CIBN localizer domain coupled to reverse Tet repressor; binds tetO sites upon doxycycline addition; CIBN is bound by PHR upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-1574/+120
Plasmid#35539DepositorUseLuciferaseTagsluciferasePromoternoneAvailable SinceJune 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmeIF4G-trunc-V5His6_G
Plasmid#146392PurposeInsect Expression of DmeIF4G-trunc. *Note: this plasmid does not contain an HA-tag as the name implies.DepositorInsertDmeIF4G-trunc (eIF4G1 Fly)
ExpressionInsectMutation322-1666 truncated version of elF4G sequence with…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-hWIPI1A-3×FLAG
Plasmid#215509PurposeExpresses FLAG tagged human WIPI1A.DepositorInsertWD-repeat protein interacting with phosphoinositides 1A (WIPI1 Human)
UseRetroviralTags3×FLAGExpressionMammalianAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAVA-Gal11p-LGF2(fs)
Plasmid#127482PurposeNegative control for the AVA-seq system. Gal11p (lambda CI associated) and LGF2 (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertGal11p-LGF2(frame shifted) (GAL11 Budding Yeast)
ExpressionBacterialMutationLGF2 is frame shifted by the insert of one nucleo…Available SinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-SV40P-Tet2 enhancer H1
Plasmid#63883PurposeLuciferase reporter plasmid used to study transcriptional control of murine Tet2DepositorInsertTet2 enhancer fragment H1
UseLuciferaseExpressionMammalianPromoterSV40Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Paragranulin+linker 1
Plasmid#176915Purposeexpress Paragranulin with linker 1 in mammalian cellsDepositorInsertParagranulin + linker 1 (GRN Human)
TagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNeuLite PEA3 mt
Plasmid#16248DepositorInsertHer-2/neu promoter (ERBB2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPEA3 mt: PEA3 motif AGGAAG changed to AGCTCGAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pJWK_VD_01
Plasmid#158102Purpose5'UTR stem-loop luciferase reporter: 0kcal/molDepositorInsert5'UTR synthetic stem-loop 0kcal/mol
UseLuciferaseExpressionMammalianPromoterPGKAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cDHFR174
Plasmid#188256PurposePlasmid ensures constitutive expression of the C-terminal fragment of split DHFR (aa 1-173), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZS1[TreR-T,LacI-T]
Plasmid#60770PurposeContains PI driving expression TreR-T, and PI driving expression of LacI-T.DepositorInsertsTreR-T
Dimeric LacI with the TAN DBD
UseSynthetic BiologyExpressionBacterialMutationDimeric LacI with the TAN DBD. and LacI/GalR repr…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti_mpx_AsCas12a(dual-gRNA)_h7SK(PacI-ClaI)_U6(I-SceI-NheI)_PGK-puro
Plasmid#189635PurposeLentiviral expression of double dual-AsCas12a gRNAs for generating combinatorial AsCas12a 3Cs librariesDepositorInserth7SK arrayed Cas12a gRNA cassette, hU6 arrayed Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only