We narrowed to 3,021 results for: COB
-
Plasmid#205881PurposeExpress mEGFP-tagged fusion protein, PAX5_ETV6 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
CL20_mEGFP_BCL9L_CBL
Plasmid#205779PurposeExpress mEGFP-tagged fusion protein, BCL9L_CBL from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ARID1B_ZNF384
Plasmid#205772PurposeExpress mEGFP-tagged fusion protein, ARID1B_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_38
Plasmid#60279PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertACSL1 enhancer (ACSL1 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_EML4_BRAF
Plasmid#205812PurposeExpress mEGFP-tagged fusion protein, EML4_BRAF from patient-derived sequenceDepositorAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_33
Plasmid#60275PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertGLIS3 enhancer (GLIS3 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_PAX5_NOL4L
Plasmid#205886PurposeExpress mEGFP-tagged fusion protein, PAX5_NOL4L from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_PAX5_FOXP1
Plasmid#205882PurposeExpress mEGFP-tagged fusion protein, PAX5_FOXP1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_AIMP2_EIF2AK1
Plasmid#205770PurposeExpress mEGFP-tagged fusion protein, AIMP2_EIF2AK1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_13
Plasmid#60298PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CCDC6_ANK3
Plasmid#205788PurposeExpress mEGFP-tagged fusion protein, CCDC6_ANK3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_SMARCA2_ZNF384
Plasmid#205922PurposeExpress mEGFP-tagged fusion protein, SMARCA2_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_20
Plasmid#60303PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
KRAS-A146T
Plasmid#154426PurposeA146T Kras with Flag tag inserted into N-terminal domain between 6Xhis tag and TEV cleavage site.DepositorInsertKRAS (KRAS Human)
Tags6xHis-tag and TEV protease cleavage sequenceExpressionBacterialPromoterT5Available SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_33
Plasmid#60312PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CCLMPC_CAT
Plasmid#237500PurposeDual promoter lentiviral expression control vectorDepositorInsertChloramphenicol acetyl transferase fusion protein
UseLentiviralExpressionMammalianPromoterMND/PGKAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_RUNX1_CBFA2T3
Plasmid#205914PurposeExpress mEGFP-tagged fusion protein, RUNX1_CBFA2T3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_PAX5_CBFA2T3
Plasmid#205878PurposeExpress mEGFP-tagged fusion protein, PAX5_CBFA2T3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_PAX5_ESRRA
Plasmid#205880PurposeExpress mEGFP-tagged fusion protein, PAX5_ESRRA from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_PAX5_KANK1
Plasmid#205884PurposeExpress mEGFP-tagged fusion protein, PAX5_KANK1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_KPNA1_GMPS
Plasmid#205844PurposeExpress mEGFP-tagged fusion protein, KPNA1_GMPS from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_LCLAT1_GREB10
Plasmid#205845PurposeExpress mEGFP-tagged fusion protein, LCLAT1_GREB1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_LMX1B_GTF3C5
Plasmid#205847PurposeExpress mEGFP-tagged fusion protein, LMX1B_GTF3C5 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MBNL1_MEIS2
Plasmid#205848PurposeExpress mEGFP-tagged fusion protein, MBNL1_MEIS2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MEX3D_DCTN6
Plasmid#205855PurposeExpress mEGFP-tagged fusion protein, MEX3D_DCTN6 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MFF_ERBB4
Plasmid#205856PurposeExpress mEGFP-tagged fusion protein, MFF_ERBB4 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_KMT2A_EPS15
Plasmid#205841PurposeExpress mEGFP-tagged fusion protein, KMT2A_EPS15 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ETV6_ABL1
Plasmid#205814PurposeExpress mEGFP-tagged fusion protein, ETV6_ABL1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ASCC1_MICU1
Plasmid#205773PurposeExpress mEGFP-tagged fusion protein, ASCC1_MICU1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ASPSCR1_METRNL
Plasmid#205775PurposeExpress mEGFP-tagged fusion protein, ASPSCR1_METRNL from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_27
Plasmid#60307PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_28
Plasmid#60308PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_32
Plasmid#60311PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_36
Plasmid#60314PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_37
Plasmid#60315PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_38
Plasmid#60316PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_39
Plasmid#60317PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_6
Plasmid#60255PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertGRM4 enhancer (GRM4 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_8
Plasmid#60257PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertKIRREL3 enhancer (KIRREL3 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_11
Plasmid#60260PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertCDKAL1 enhancer (CDKAL1 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_13
Plasmid#60261PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertEDN3 enhancer (EDN3 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_20
Plasmid#60266PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertCDKN1C enhancer (CDKN1C Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_27
Plasmid#60270PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertC16orf80 enhancer (CFAP20 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_28
Plasmid#60271PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertCRY2 enhancer (CRY2 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_32
Plasmid#60274PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertDGKB enhancer (DGKB Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_36
Plasmid#60277PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertDNMT3A enhancer (DNMT3A Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_37
Plasmid#60278PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertARHGAP26 enhancer (ARHGAP26 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_39
Plasmid#60280PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertPCSK1 enhancer (PCSK1 Human)
UseGateway CloningAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C2_10
Plasmid#60287PurposeThis plasmid contains a human pancreatic islet inactive enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only