We narrowed to 2,963 results for: PHI-1
-
Plasmid#201249Purposeallows the expression of the insert in Drosophila melanogasterDepositorInsertɑ-Synuclein (SNCA Human)
ExpressionInsectAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRB133.2
Plasmid#181950PurposeaTc-inducible expression of PhoP with C-terminal mNeonGreen fusion. Also contains mCherry under PhoP-controlled promoter PvirKDepositorInsertPhoP-Salmonella enterica subsp. enterica serovar Typhimurium (AX04_RS23485 PhoP-Salmonella enterica subsp. enterica serovar Typhimurium, Synthetic)
TagsmNeonGreenExpressionBacterialPromoterPhoP-mNG-PLtetO-1; mCherry-PvirK; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-GST-DmNanos_50-236_AC
Plasmid#148465PurposeInsect Expression of DmNanos_50-236DepositorInsertDmNanos_50-236 (nos Fly)
ExpressionInsectMutationone non silent mutation D121G compared to the seq…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMTV neu NT
Plasmid#1823DepositorInsertneu NT (Erbb2 Rat)
ExpressionMammalianAvailable SinceJuly 18, 2005AvailabilityAcademic Institutions and Nonprofits only -
pUB-cSypHer
Plasmid#84733PurposeExpresses SypHer in plant cells-biosensor for pHDepositorInsertSypHer
ExpressionPlantPromoterubiqutin- 10 gene promoter (pUBQ10) of ArabidopsisAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
nos-Cas9.874Z1
Plasmid#112685PurposeExpress hSpCas9 under nanos promoterDepositorInserthSpCas9
Tags3x FLAG, EGFP, and NLSExpressionInsectMutationHumanized Cas9 bacterial sequencePromoternanosAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ubiq-Cas9.874W
Plasmid#112686PurposeExpress hSpCas9 under Ubiquitin-63E promoterDepositorInserthSpCas9
Tags3x FLAG, EGFP, and NLSExpressionInsectMutationHumanized Cas9 bacterial sequencePromoterUbiquitin-63E promoterAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUB-cHyPer2
Plasmid#84728PurposeExpresses HyPer2 in plant cells-biosensor for Hydrogen peroxideDepositorInsertHyPer2
ExpressionPlantPromoterubiqutin- 10 gene promoter (pUBQ10) of ArabidopsisAvailable SinceJune 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
vas-Cas9.874Z
Plasmid#112687PurposeExpress hSpCas9 under vasa promoterDepositorInserthSpCas9
Tags3x FLAG, EGFP, and NLSExpressionInsectMutationHumanized Cas9 bacterial sequencePromotervasaAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGem-nHyPer2:sHyper2
Plasmid#84737PurposeSimultaneous expresion of nuclear and stromal HyPer2 in plant cellsDepositorInsertHyPer2 targeted to nucleus
TagsNLS-SV40ExpressionPlantPromoterpFMV/p35SAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZA13
Plasmid#158491PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 without STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationno STOP codonAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJFRC7-JEDI-1P
Plasmid#202618PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P under the promoter hsp70 for Drosophila (insect) expressionDepositorInsertJEDI-1P
ExpressionInsectPromoterhsp70Available SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZA5
Plasmid#158483PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 with STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationSTOP codonAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_spatzle-HA
Plasmid#240227PurposeGateway entry clone with spatzle tagged with HA (contains stop codon)DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA1
Plasmid#186663PurposeNbr C-tag sgRNA1 plasmidDepositorInsertNbr sgRNA 1 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
p28-2iDP-puro
Plasmid#88893PurposeDual-intron DMD platform plasmid. Co-expresses DMD platform segment, firefly luciferase, puroR and mCherry. Plasmid carries phiC31 and Bxb1 attB sites.DepositorInsertsDual-intron DMD platform
luciferase
puromycin resistance enzyme
mCherry
ExpressionMammalianMutationTruncated version of the dystrophin protein (tran…Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pEB2-mNeptune2.5
Plasmid#104013PurposePlasmid encoding mNeptune2.5DepositorInsertmNeptune2.5
UseLow copyExpressionBacterialMutationMutations relative to eqFP578 (MSKGEE LIKENM… M11…PromoterproCAvailable SinceDec. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB1-moxCerulean3
Plasmid#103975PurposePlasmid encoding moxCerulean3DepositorInsertmoxCerulean3
UseLow copyExpressionBacterialMutationMutations relative to wild-type GFP (F64L, Y66W, …PromoterproCAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPerimCh
Plasmid#227013PurposeExpresses periplasmic mCherryDepositorInsertPelB-mCherry, arabinose inducible cytosolic GFP
ExpressionBacterialPromoterrpsM and pBADAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
DAXX-myc-his
Plasmid#1852DepositorAvailable SinceMay 4, 2005AvailabilityAcademic Institutions and Nonprofits only -
pZA8
Plasmid#158486PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 L17E/D481V with STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationL17E, D481V, STOP codonAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mNeptune2
Plasmid#104012PurposePlasmid encoding mNeptune2DepositorInsertmNeptune2
UseLow copyExpressionBacterialMutationMutations relative to eqFP578 (MSKGEE LIKENM… R32…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mRFP1*
Plasmid#104000PurposePlasmid encoding mRFP1*DepositorInsertmRFP1*
UseLow copyExpressionBacterialMutationMutations relative to DsRed (MSKGEE NNLAVIKEF...T…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mRFP1
Plasmid#104001PurposePlasmid encoding mRFP1DepositorInsertmRFP1
UseLow copyExpressionBacterialMutationMutations relative to DsRed (R2A, K5E, N6D, T21S,…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZA7
Plasmid#158485PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 L17E with STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationL17E, STOP codonAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA15
Plasmid#158493PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 L17E without STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationL17E, no STOP codonAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA6
Plasmid#158484PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 D481V with STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationD481V, STOP codonAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZA14
Plasmid#158492PurposeEntry clone for Golden Gate assembly. Golden gate compatible N. benthamiana ZAR1 D481V without STOP codonDepositorInsertZAR1
UseGolden gate entry vectorMutationD481V, no STOP codonAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUAS-spatzle-HA
Plasmid#240235PurposeExpression of spatzle-HA under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
ClhN-HIS5
Plasmid#207014PurposePlasmid backbone for yeast expression, use auxotrophic marker HIS5 (Schizosaccharomyces Pombe)DepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
ClhN-MET15
Plasmid#207013PurposePlasmid backbone for yeast expression, use auxotrophic marker MET15 (Saccharomyces cerevisiae)DepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
ClhN-URA3
Plasmid#207012PurposePlasmid backbone for yeast expression, use auxotrophic marker URA3 (Kluyveromyces lactis)DepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUWR-CadTS-C
Plasmid#58326PurposeDestination vector for inserting ubi-CadTS control to Drosophila melanogaster genomeDepositorInsertE-cadherin tension sensor control
ExpressionInsectPromoterpoly-ubiquitinAvailable SinceAug. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
PL-452 C-EGFP
Plasmid#19178DepositorInsertEGFP
UseCre/LoxAvailable SinceOct. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
PL-452 N-EGFP
Plasmid#19173DepositorInsertEGFP
UseCre/LoxAvailable SinceOct. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
PL-452 C-Flag-4C
Plasmid#19180DepositorInsertFLAG tetracysteine tag
UseCre/LoxAvailable SinceOct. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
PL-452 C-mDsRed
Plasmid#19179DepositorInsertmDsRed
UseCre/LoxAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
PL-452 N-Flag-4C
Plasmid#19175DepositorInsertFLAG tetracysteine tag
UseCre/LoxAvailable SinceOct. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
PL-452 C-YPet
Plasmid#19177DepositorInsertYPet
UseCre/LoxAvailable SinceOct. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
PL-452 N-YPet
Plasmid#19172DepositorInsertYPet
UseCre/LoxAvailable SinceOct. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
PL-452 N-mDsRed
Plasmid#19174DepositorInsertmDsRed
UseCre/LoxAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
PL-452 C-CyPet
Plasmid#19176DepositorInsertCyPet
UseCre/LoxAvailable SinceOct. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
PL-452 N-CyPet
Plasmid#19171DepositorInsertCyPet
UseCre/LoxAvailable SinceOct. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
EF2451_pET21a(+)
Plasmid#13840DepositorInsertPPAT
TagsHisExpressionBacterialAvailable SinceJune 29, 2007AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TUBA1B
Plasmid#207763PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of TUBA1B for knock-in.DepositorInsertsgRNA Targeting N-terminus of TUBA1B (TUBA1B Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS16 (Peft-3::wrmScarlet::tbb-2 3'UTR in pUC19)
Plasmid#154824Purpose(eft-3p::wrmScarlet::tbb-2 3'UTR in pUC19) Experimentally used to mark formation of transgenic arrays for C. elegansDepositorInsertPeft-3::wrmScarlet::tbb-2 UTR
ExpressionWormPromotereef-1A.1 (eft-3)Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only