We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#210626PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_Ex3_3
Plasmid#210627PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_Ex3_4
Plasmid#210628PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
IR76b-T2A-QF2
Plasmid#162523PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir76b geneDepositorInsertIr76b-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir76b-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
GR3-T2A-QF2
Plasmid#162521PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Gr3 geneDepositorInsertGr3-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Gr3-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
IR8a-T2A-QF2
Plasmid#162520PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir8a geneDepositorInsertIr8a-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir8a-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-TBG-Cre-sgArid1a
Plasmid#192165PurposeAAV-TBG-Cre-sgArid1aDepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-TBG-Cre-sgKmt2d
Plasmid#192164PurposeAAV-TBG-Cre-sgKmt2dDepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
IR25a-T2A-QF2
Plasmid#162522PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir25a geneDepositorInsertIr25a-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir25a-right-HDR-arm
ExpressionInsectAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_Std_Dual_epegRNA_tevopreQ1
Plasmid#187457PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 pegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N pegRNA (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-42-DExCon-antiGFPnanobody-mCherry-R11a
Plasmid#179902PurposeDonor with homologous arms for Rab11a to knock in DExCon-antiGFPnanobody-mCherry moduleDepositorInsertRAB11A, member RAS oncogene family (RAB11A Human)
UseCRISPR; Donor for homologous based knock inTagsantiGFPnanobody-mCherryExpressionBacterial and MammalianPromoterTRE3GSAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.4.EFS-NS.H2B-RFP
Plasmid#170365PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.3.EFS-NS.H2B-RFP
Plasmid#170364PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
FMR1-E17B-P2A-NLuc
Plasmid#157857Purposedonor plasmid for FMR1-NlucDepositorAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_2
Plasmid#155066PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_1
Plasmid#155069PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_2
Plasmid#155070PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only