We narrowed to 9,596 results for: Pol
-
Plasmid#167453PurposeExpresses C.elegans PUP-2 linked to RNA-recognition motifs (RRMs) of yeast poly(A)-binding protein [PUP alone (+PAB)] from the Sec63 promoterDepositorInsertPSEC63_yeGFP_scPAB14RRMS_cePUP-2_URA3_TADH1
ExpressionYeastPromoterPSEC63AvailabilityAcademic Institutions and Nonprofits only -
pHCMM3
Plasmid#167454PurposeA control chimera; expresses C. elegans PUP-2 from the Sec63 promoter without the RNA-recognition motifs (RRMs) of yeast poly(A)-binding protein [PUP alone (-PAB)]DepositorInsertPSEC63_yeGFP_cePUP-2_URA3_TADH1
ExpressionYeastPromoterPSEC63AvailabilityAcademic Institutions and Nonprofits only -
pFastBac(His10-Lckg2a,Y394F)
Plasmid#177893PurposeBaculo expression of His10 tag fused to human LckG2ADepositorAvailabilityAcademic Institutions and Nonprofits only -
pLIB-GST-TEV-RSP3(160-516)
Plasmid#176692PurposeExpression of Chlamydomonas reinhardtii RSP3 recombinant protein in insect cellsDepositorInsertRSP3
TagsGSTExpressionInsectMutationNonePromoterpolyhedrinAvailabilityAcademic Institutions and Nonprofits only -
IL2 F42A pAcGP67a
Plasmid#41807DepositorInsertIL2 (IL2 Human)
Tags6x HisExpressionInsectMutationPhenylalanine 42 to AlaninePromoterPolyhedronAvailable SinceJan. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAcGP67A-hBAI3-HormR-GAIN
Plasmid#37848DepositorInsertBAI3 (BAI3 Human)
UseBaculovirus transfer vectorsTags8xHISMutationHormR and GAIN domains only (aa498–868PromoterPolyhedrinAvailable SinceJuly 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 Lysosomal-METRIQ
Plasmid#135401PurposeExpresses lysosomal-METRIQ (DNAse II-sfGFP together with cytosolic RFP) to measure lysosomal activityDepositorInsertDNAse II alpha (DNASE2 Human)
UseLentiviralTagsT2A, mCherry, and sfGFPExpressionMammalianMutationSingle-nucleotide polymorphism C432TAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-TREG3G-PE2-rtTA3G-P2A-eGFP
Plasmid#196971PurposePiggybac vector with doxycyclin-inducible prime editor for mammalian cellsDepositorInsertsCas9-RT
rtTA3G-P2A-eGFP
ExpressionMammalianPromoterPGK and TREG3GAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1NF
Plasmid#175279PurposeAAV vector mediating inducible expression of the NS1 gene of YFV-17DDepositorAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBacDual with LFn + Needle
Plasmid#84868PurposeBaculovirus Expression of LFn-Needle fusion. The LFn domain acts as a signal sequence that targets proteins for cytosolic translocation via the co-administered protective antigen (PA) channel proteinDepositorInsertsLFn
Needle
UseBaculovirusTags6xHisExpressionInsectPromoterPolyhedrinAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCB’
Plasmid#162703PurposepCB reconstructed after selection for CCMB1 growth on glycerol under ambient airDepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialMutation5513T>G (tetR E37A); 7758G>T (second tet op…PromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-P2A-PuroR
Plasmid#196962PurposeExpresses PE2 with puromycin resistanceDepositorInsertPE2-P2A-Puro
ExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV GAG
Plasmid#234992PurposeFor production of Viral like particles (VLPs) by expressing the MLV GAG protein in mammalian cellsDepositorInsertGAG
ExpressionMammalianMutationDeleted polymerase coding sequenceAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
AY27_pU6.gRNA.CLYBL
Plasmid#199238PurposeExpression construct encoding a S. pyogenes guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. pyogenes gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET29b-AviTag-eGFP-dspB(E184Q W330Y)-6xHis
Plasmid#175801PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein eGFP-DspB(E184Q W330Y), used as a non-binding control for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAviTag, Hexahistidine tag, and eGFPExpressionBacterialMutationE184Q W330YPromoterT7Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB
Plasmid#52889Purpose"CoinFLP-Gal4" - Expresses Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express Gal4, or FRT3-FRT3 pair to prevent Gal4 expressionDepositorInsertGal4 (GAL4 Budding Yeast)
ExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3M5M_eGFP
Plasmid#135474PurposeEncodes Marburg virus minigenome with eGFP reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, eGFP reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBabePuro-ApoECDS
Plasmid#42949DepositorAvailable SinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only