We narrowed to 3,503 results for: cgas
-
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-MYADM
Plasmid#235245PurposeEncodes gRNA for human MYADMDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Frodo-eCMV-SaSpD10A (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210734PurposeCoding for SaSp D10A Cas9 alongside Frodo sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Frodo sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbPDS
Plasmid#231146PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbPDSDepositorInsertTREX2 and mobile gRNA targeting NbPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-2_NbPDS
Plasmid#231145PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbPDSDepositorInsertTREX2 and mobile gRNA targeting NbPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-MYD88-ts3
Plasmid#174282PurposeMYD88 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPU-HSA-miR30-L1221
Plasmid#174221PurposeAll-in-one control rescue-control shRNA knockdown vectorDepositorInsertHSA
UseLentiviral and RNAiExpressionMammalianPromoterSFFVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-DNM1L -GFP
Plasmid#221845PurposeTol2 transposon expressing sgRNA targeting chick DNM1L from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
DNM1L sgRNA-gTGTTTTCCGACCATCCTCTG
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGC and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
rSirt3 shRNA (pLKO.1 vector)
Plasmid#216807PurposeshRNA against rat Sirt3DepositorAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgRPA1-2_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211659PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgRPA1-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgNT-2_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211653PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgNT-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgNT-3_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211654PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgNT-3 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Merry-eCMV-SaSpD10A+linker (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210736PurposeCoding for SaSp D10A Cas9 alongside Merry sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Merry sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT2/sh-FYN1-GFP_Seq_C
Plasmid#201399PurposeKnockdown of FYN tyrosine kinase. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertFYN
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
HSF2 KO
Plasmid#200208PurposegRNA for HSF2 KODepositorAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::axed{sgRNA})
Plasmid#187883PurposeGal4/UAS sgRNA expression targeting axedDepositorInsert4 sgRNAs targeting axed
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.040
Plasmid#184974PurposeTest effect of extending a1/a2 on ADE2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 27 v2
ExpressionYeastMutationADE2 donor P272stop, a1/a2 length extended to 27 …PromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.108
Plasmid#184977PurposeExpress -Eco1 LYP1 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 12
ExpressionYeastMutationLYP1 donor E27stopPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.109
Plasmid#184978PurposeTest effect of extending a1/a2 on LYP1 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 27 v1
ExpressionYeastMutationLYP1 donor E27stop, a1/a2 length extended to 27 bpPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW229-lenti-sg2-mmSerpinh1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189945PurposeLentiviral vector to co-express a mouse Serpinh1 spsgRNA (sg2-Serpinh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Serpinh1 spsgRNA #2
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW230-lenti-sg3-mmSerpinh1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189946PurposeLentiviral vector to co-express a mouse Serpinh1 spsgRNA (sg3-Serpinh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Serpinh1 spsgRNA #3
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.002
Plasmid#184972PurposeExpress -Eco1 ADE2 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 12
ExpressionYeastMutationADE2 donor P272stopPromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.039
Plasmid#184973PurposeTest effect of extending a1/a2 on ADE2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, ADE2 P272X, a1/a2 length: 27 v1
ExpressionYeastMutationADE2 donor P272stop, a1/a2 length extended to 27 …PromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.dora_2
Plasmid#190701PurposeExpresses sgRNA targeting Dora gene and Cas9-Puro in Drosophila S2 cellsDepositorInsertdora (CG34401) sgRNA 2
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato166/892
Plasmid#188488PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 166 & 892.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFAP4_BHLH_3-2
Plasmid#185055PurposeDeletion of BHLH domain of mouse TFAP4 in combination with TFAP4_BHLH_5-1 or TFAP4_BHLH_5-2DepositorInsertTFAP4_3_2_gRNA (Tcfap4 Mouse)
UseLentiviralAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9344 (pgRNA_XVI-1_NatMX)
Plasmid#161596PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XVI-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Ski-gRNA1
Plasmid#180368Purposetargeting mouse Ski geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK17 pCAS-Tyr-[gRNA: 7=HIS3] (SplitKanR, AmpR)
Plasmid#179001PurposeSp.Cas9 and gRNA yeast expression vector with HIS3 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
Eomes gRNA#3
Plasmid#170836PurposeCas9-mediated knockout of Eomes in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK_1
Plasmid#163462Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADKDepositorInsertsgRNA 1 targeting NADK (NADK Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS424-ysg(G:H)
Plasmid#138257PurposeExpression of GFP-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequence to be used in yeast dual reporter systemDepositorInsertGFP targeting sgRNAs G and H
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(G:H)
Plasmid#138259PurposeExpression of humanized mCherry-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequences to be used in Traffic Light reporter systemDepositorInsertmCherry targeting sgRNAs G and H
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only