We narrowed to 15,506 results for: LIS
-
Plasmid#179556Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pLVX-CMV-XRCC1-gRNA res-Neo
Plasmid#176149PurposeXRCC1 with dual PAM resistance to XRCC1 gRNA1 and XRCC1 gRNA2 & a neomycin/G418 resistance cassetteDepositorInsertX-ray repair cross complementing 1 (XRCC1 Human)
UseLentiviralExpressionMammalianMutationDual PAM resistance to XRCC1 gRNA 1 and XRCC1 gRN…PromoterCMVAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB120
Plasmid#167150PurposeMoClo-compatible Level 1 (position 1) vector encoding Kanamycin resistance cassette, for expression in plantsDepositorInsertpNOS-nptII-ocsT
ExpressionPlantPromoterpNOSAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00005
Plasmid#166722PurposesgRNA against human ASNSDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00006
Plasmid#166723PurposesgRNA against human ASNSDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAWp28-v1 scaffold
Plasmid#157976PurposepBT264-U6p-{2xBbsI}-v1 sgRNA scaffold-{MfeI} Note: This plasmid is unstable. Screen multiple colonies to identify full length clones.DepositorTypeEmpty backboneAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
p28BIOHTEV-LIC: nsp16_SARS-CoV-2|nsp10_SARS-CoV-2
Plasmid#167848PurposeBacterial expression of the SARS-CoV-2 proteins nsp10 and nsp16 from a bicistronic mRNADepositorInsertnsp10, nsp16
Tags6xHis and AviTagExpressionBacterialPromoterT7Available SinceApril 22, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-EF1a-KIF5AR280H-HA-IRES-Puro
Plasmid#166953PurposeLentiviral plasmid expressing HA-tagged KIF5A R280H protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
BE3-hA3A-Y130F
Plasmid#132945PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertBE3-hA3A(Y130F)
UseCRISPR; Base editorExpressionMammalianMutationBE3-hA3A(Y130F)Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-CRY2PHR-SID4X
Plasmid#63663PurposeAAV expression of CRYS2PHR-SID4XDepositorInsertSID4X-CYR2PHR
UseAAVExpressionMammalianPromoterEF1alphaAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
WPXL SOX10 gRNA
Plasmid#101923PurposeSOX10 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertSOX10 promoter targeting gRNA
UseLentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
hSyn Marina-T2A-nls-mCherry
Plasmid#85843Purposegenetically-encoded fluorescent voltage indicatorDepositorInsertGEVI Marina
TagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterhSyn1Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-myc-BKαΔM-GFP-V5-His
Plasmid#255910PurposeComplementary plasmid for co-expression with BKαΔM module to form functional BK channels. BKα residues 94–651 are replaced by a flexible peptide linker and GFP is tagged at C-terminus.DepositorInsertKCNMA1 (partial) (KCNMA1 Human)
TagsEGFP-V5-6xHis and MycExpressionMammalianMutationresidues 94–651 are deleted and replaced by a fle…Available SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
dpYPQ230-RRV-CBE
Plasmid#250717PurposedLbCas12a-RRV based cytosine base editor, hA3A/Y130F fused to the N terminal of dLbCas12a-RRV with the linker of (GGGGS)x6DepositorInserthA3A/Y130F-(GGGGS)x6-dLbCas12a-RRV-UGI
UseCRISPRTags5' and 3' NLSExpressionPlantAvailable SinceJune 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pluc HYG 5’ CYSTM α
Plasmid#247490PurposePlasmid pluc 5′ CYSTM α contains a 79-nt Arabidopsis 5′ UTR fragment upstream of Firefly luciferase, functioning as a potent translational enhancer in plant assays.DepositorInsert5′ CYSTM α (From the 5' UTR of CYSTM1 gene)
UseLuciferaseTagsn/aExpressionBacterial and PlantPromoterCaMV 35SAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only