We narrowed to 9,978 results for: crispr plasmids
-
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
T7_CC_PE7_IVT_Template
Plasmid#223022PurposeTemplate for in vitro transcription of PE7. For HSPC-related experiments.DepositorInsertPE7
UseTemplate for in vitro transcriptionTagsSV40 bpNLS and c-Myc NLSPromoterT7Available SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV_iPE-C_P2A_Csy4
Plasmid#232428PurposeExpression plasmid for iPE-C prime editor RNPs with additional Csy4 protectionDepositorInsertiPE-C–P2A–Csy4
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7
Plasmid#214812PurposeMammalian expression of SpCas9 PE7 prime editorDepositorInsertPE7
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-PE7 for IVT
Plasmid#214813PurposeTemplate for in vitro transcription of PE7DepositorInsertPE7
UseTemplate for in vitro transcriptionTagsSV40 bpNLS and c-Myc NLSPromoterT7 (inactivated)Available SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6b
Plasmid#207852PurposeMammalian expression of PE6b prime editorDepositorInsertPE6b
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationTf1rt(P70T, G72V, S87G, M102I, K106R, K118R, I128…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-mCherry-P2A-Cre-WPRE
Plasmid#107312PurposeEncoding hSyn-mCherry-CreDepositorHas ServiceAAV1InserthSyn-mCherry-P2A-Cre-WPRE
UseAAVExpressionMammalianAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19_msfGFP-TCOF1-repair-template
Plasmid#237632PurposeFor knock-in msfGFP to TCOF1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBFC0993
Plasmid#231993PurposeCRISPRi-ART plasmid encoding aTc-inducible dRfxCas13d and constitutive crRNA with negative control (RFP-targeting) spacerDepositorInsertsdRfxCas13d
crRNA with negative control (RFP-targeting) spacer
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and pTetAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
evoFERNY-Cas9NG
Plasmid#203329PurposePlasmid for bacterial purification of codon optimized evoFERNY-Cas9NGDepositorInsertevoFERNY-Cas9NG
UseCRISPRTagsHis-tagExpressionBacterialAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
DHC1-AID-Clover donor (Hygro)
Plasmid#158622PurposeDonor plasmid for tagging DHC1 with AID-CloverDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPR; Tagging donorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY093-EFS-BCMA-Blast-WPRE
Plasmid#192194PurposeLenti-BCMA-OE-BlastDepositorAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-602_NY-ESO-1_TCR_RFP
Plasmid#207483PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP, NY-ESO-1_TCR
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXD023 - pLKO-EF1a-Puro-P2A-FLuc-WPRE
Plasmid#192203PurposeLenti-PL(Puro-Luciferase)DepositorInsertLenti-PL(Puro-Luciferase)
UseLentiviral; Mammalian expressionMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-601_NY-ESO-1_TCR_GFP
Plasmid#207482PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertGFP, NY-ESO-1_TCR
UseCRISPRMutationPotential silent point mutation in GFP sequenceAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXD024 - pLKO-EF1a-GFP-P2A-FLuc-WPRE
Plasmid#192204PurposeLenti-GL(GFP-Luciferase)DepositorInsertLenti-GL(GFP-Luciferase)
UseLentiviral; Mammalian expressionMutationNAAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-mStayGold-polyA-Hygro HR
Plasmid#229679PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with monomeric StayGold. Contains a hygromycin resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-EF1α-sakkhCas9-HA-NLS-polyA-CBh-EGFP-polyA
Plasmid#168305Purposemediated knock-in of sgRNA precursorDepositorInsertSaKKH-EGFP-U6-sgRNA
UseAAVExpressionMammalianPromoterEF1alpha, CBhAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only