We narrowed to 24,909 results for: promoter
-
Plasmid#251692PurposegRNA to knock out MT1X in mammalian cellsDepositorInsertMT1X metallothionein 1X (MT1X Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMT1X-2
Plasmid#251693PurposegRNA to knock out MT1X in mammalian cellsDepositorInsertMT1X metallothionein 1X (MT1X Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.SFFV.Cre.IRES.dTomato
Plasmid#187192PurposeLentiviral overexpression of Cre recombinaseDepositorInsertCre recombinase (cre Escherichia phage P1 (isolate: mod749::IS5 c1.100 mutant, nat-host: Escherichia coli))
UseLentiviralAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HSE-CytoTape-V5
Plasmid#239426PurposeCytoTape signal monomer for recording HSE promoter transcriptional activityDepositorInsertCytoTape-V5 (HSPA1A Synthetic)
UseAAVTagsV5-dMBPExpressionMammalianPromoterHSPA1A promoterAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Ub-Myc-LgBiT
Plasmid#241817PurposeExpresses Myc-tagged and LgBiT-tagged Ubiquitin for use with the Promega HiBiT systemDepositorInsertUbiquitin
TagsLgBiT and MycExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV KI Cloning Vector_hSyn mTagBFP2-CAAX2
Plasmid#236245PurposeCloning template for knock-in based strategy with U6 promoter, gRNA and donor tag cloning cassettes, and a fluorescent marker for the plasma membrane under hSyn promoterDepositorInsertmTagBFP2 fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmTagBFP2PromoterU6 and human Synapsin1Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
PSIN4-3_Flag-ATP5MG
Plasmid#232951PurposeExpresses ATP5MGDepositorInsertATP5MG (ATP5MG Human)
UseLentiviralAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-ATP5MF
Plasmid#232950PurposeExpresses ATP5MFDepositorInsertATP5MF (ATP5MF Human)
UseLentiviralAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-ATP5PB
Plasmid#232949PurposeExpresses ATP5PBDepositorInsertATP5PB (ATP5F1 Human)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V1
Plasmid#222503PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V1 (R887E) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V1 (R887E) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E in Dnmt3APromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V2
Plasmid#222505PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V3
Plasmid#222506PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V3 (R887E and E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V3 (R887E and E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E and E814…PromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-catΔ
Plasmid#222508PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant catΔ (C706A and R832E) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant catΔ (C706A and R832E) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; C706A and R832…PromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing mSA for template recruitment and ePhi29 DNA polymerase - pCMV-T7-mSA-nCas9-ePhi29 (JO1398)
Plasmid#217803PurposeVariant CE1 construct with mSA for template recruitment and ePhi29(D169A) DNA pol, expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-nSpCas9-BPNLS-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); Phi29(D169A/M8R/V51A/M97T/G197D/E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TNT4-TadA8e-SpRY N aa2-713-InteinN-miR122 TS
Plasmid#209787PurposeExpresses TadA8e and SpRY cas9N by the specific TNT4 promoter and incorporation of the miR122 target sequences (miR122TS) into the 3’ untranslated region (3’ UTR)DepositorInsertTNT4, TadA8e, SpRY N, inteinN, miR122 TS
UseAAVPromoterTNT4Available SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
sh4p-ZMYND8-mouse
Plasmid#201405PurposeKnockdown of Zinc Finger MYND Type-8. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertZMYND8
ExpressionMammalianAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV-PGK-PVR-P2A-Cre-EFS-mScarletSIIN
Plasmid#172435PurposeLentivirus, expresses Cre recombinase, mouse PVR (CD155), and mScarlet-SIINFEKLDepositorInsertsCre
PVR
mScarlet-SIINFEKL(OVA257-264)+Ova 323-339
UseLentiviralAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
IL2-AH-2A-Cherry-RhoAQ63L in pmCherryN1
Plasmid#187287PurposeExpress pmCherry-IL2-AH-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH-2A-RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only