We narrowed to 1,647 results for: Tyr
-
Plasmid#31138DepositorInsertADAM7 (ADAM7 Human)
UseTagsFLAGExpressionMammalianMutationHistidine 243 changed to TyrosinePromoterAvailable sinceSept. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4-delta-kinase-PY3 mutant
Plasmid#17802DepositorInsertErbB4 (ERBB4 Human)
UseTagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 988-1292, …PromoterAvailable sinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EphB4
Plasmid#200983PurposeMammalian expression plasmid for myc-tagged EphB4DepositorInsertEphB4 (EPHB4 Human)
UseTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-BCR-ABL-p210-ΔTK-FLAG
Plasmid#205630PurposeExpression of BCR-ABL oncogene in mammalian cellsDepositorInsertBCR-ABL oncogene, p210 isoform b3a2
UseTagsFLAGExpressionMammalianMutationdeleted tyrosine kinase (TK) domainPromoterCMVAvailable sinceSept. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-ErbB1(F992)
Plasmid#197365PurposeEncoding human ErbB1 mutant.DepositorInsertEGFR mutant (EGFR Human)
UseTagsExpressionMammalianMutationTyrosine 992 to PhenylalaninePromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcmv3-IRG1-H277Y-HA
Plasmid#198185PurposeMammalian expression of HA-tagged human ACOD1 (IRG1) H277YDepositorInsertACOD1 (ACOD1 Human)
UseTagsHAExpressionMammalianMutationThe histidine in IRG1 at position 277 mutates to …PromoterCMVAvailable sinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-PD-1 (BTLA ITIM)-mGFP
Plasmid#180817PurposeExpression of human PD-1 with immunoreceptor tyrosine-based inhibitory motif (ITIM) from BTLA, fused to mEGFPDepositorInsertPD-1 (BTLA ITIM) (PDCD1 Human)
UseLentiviralTagsmEGFPExpressionMutationreplaced PD-1-ITIM (VDYGEL) with BTLA-ITIM (IVYAS…PromoterSFFVAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQlinkG2-PTPIP51(236-470)
Plasmid#170534PurposeExpresses Cleavable GST-tagged PTPIP51 TPR domain (236-470) in E. ColiDepositorInsertProtein tyrosine phosphatase interacting protein 51 (RMDN3 Human)
UseTagsGST tagExpressionBacterialMutationPromoterT5 promoterAvailable sinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQlinkH-PTPIP51(236-470)
Plasmid#170530PurposeExpresses Cleavable His-tagged PTPIP51 TPR domain (236-470) in E. ColiDepositorInsertProtein tyrosine phosphatase interacting protein 51 (236-470) (RMDN3 Human)
UseTagsHis tagExpressionBacterialMutationPromoterT5 promoterAvailable sinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSMT3-FBF2 AQ/Y
Plasmid#166975PurposeExpresses FBF-2 with AQ/Y mutations in repeat 5 in E. coli for purification and crystallization studiesDepositorInsertFBF-2 (fbf-2 Nematode)
UseTagsHis-SUMOExpressionBacterialMutationFBF-2 PUM RNA binding domain; amino acids 164-575…PromoterT7Available sinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3508 (YCp LEU2 Rpb1 Y1473A)
Plasmid#91811PurposeYeast expression of S. cerevisiae Rpb1 with a Y1473A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
UseTagsExpressionYeastMutationchanged tyrosine 1473 to alaninePromoterEndogenous Rpb1 promoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_EPHB4_Ephrin-lbd
Plasmid#109863PurposeProtein expression and purification of EPHB4_Ephrin-lbdDepositorInsertEPHB4_Ephrin-lbd (EPHB4 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 GABARAPL1 no-stop
Plasmid#123210PurposeGateway entry clone encoding human GABARAPL1 lacking stop codon, suitable for C-terminal taggingDepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseGateway entry vector / entry cloneTagsExpressionMutationStop codon removedPromoterAvailable sinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 GABARAPL2 no-stop
Plasmid#123211PurposeGateway entry clone encoding human GABARAPL2 lacking stop codon, suitable for C-terminal taggingDepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
UseGateway entry vector / entry cloneTagsExpressionMutationStop codon removedPromoterAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-N-SH2+IA
Plasmid#111273Purposeexpress murine Syk (N)SH2 domain plus interdomain A (Ser 8 to His 162), with an N-terminal (His)6 tag and TEV cleavage site, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk (N)SH2 domain plus interdomain A (Ser 8 to His 162), with an N-terminal (His)6 tag and TEV cleavage site (Syk Mouse)
UseTagsHHHHHHENLYFQGExpressionBacterialMutationPromoterT7 promoterAvailable sinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSM4
Plasmid#101642PurposeEncodes the fluorescent protein KCyG4219 for constitutive expression in E. coli.DepositorInsertKCyG4219
UseTags6XHisExpressionBacterialMutationC-terminal residues (221-223) deletion. Ser220Val…PromoterAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
csd2_121-308,Y197F/pET28b(+)
Plasmid#83299Purposecsd2, construct: 121-308, pET28b(+) NC-tag, mutation: Y197FDepositorInserthp1544
UseTagsHis tagExpressionBacterialMutationdeleted amino acid 1-120, and changed Tyrosine 19…PromoterAvailable sinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pScalps_puro_mIL-2Rα ST
Plasmid#59919PurposeExpresses mouse interleukin-2 receptor alpha chain mutatedDepositorInsertinterleukin 2 receptor alpha (Il2ra Mouse)
UseLentiviralTagsExpressionMutationchanged sequence of the intracellular (C-terminal…PromoterAvailable sinceOct. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4-delta-kinase-PY1 mutant
Plasmid#17801DepositorInsertErbB4 (ERBB4 Human)
UseTagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 988-1292, …PromoterAvailable sinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EphB2
Plasmid#200982PurposeMammalian expression plasmid for myc-tagged EphB2DepositorInsertEphB2 (EPHB2 Human)
UseTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-PM-RA-BlastR
Plasmid#211708PurposeLentiviral expression of a ddFP subunit (RA) fused with the lipid modification motif of lymphocyte-specific protein tyrosine kinase (Lck) for plasma membrane (PM) targetting (PM-RA)DepositorInsertPM-targetted RA (Lck Synthetic)
UseLentiviralTagsRAExpressionMammalianMutationPromoterCMVAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-Y1699C
Plasmid#25048DepositorInsertLRRK2 (LRRK2 Human)
UseTagsGFPExpressionMammalianMutationTyrosine 1699 mutated to CysteinePromoterAvailable sinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A-2A-GFP
Plasmid#118270PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianMutationPromoterCMV with beta global intronAvailable sinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
8xNFAT-ZsG-muhCD4
Plasmid#162745PurposeNFAT-driven ZsGreen-1 reporter gene with mutated human CD4 geneDepositorInsert8x of NFAT binding motif follwed by ZsGreen-1 fluorescent protein gene (CD4 Human)
UseRetroviralTagsExpressionMammalianMutationHuman CD4 gene with glutamine to tyrosine at posi…PromoterAvailable sinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-v2 RsTAL At4CL
Plasmid#126524Purposeexpresses TAL (Rhodobacter sphaeroides) and 4CL (Arabidopsis thaliana paralog 1) for PYP chromophore biosynthesisDepositorInsertsUseTagsHisExpressionBacterialMutationPromoterT7Available sinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-cSrc
Plasmid#214233PurposeBacterial expression of the kinase domain of cSrc with a TEV-cleavable N-terminal 6xHis affinity tag; For in vitro tyrosine phosphorylation in peptides/proteins and for kinase specificity screeningsDepositorInsertcSrc Kinase domain (SRC Human)
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xEcoLeuT(CUA)_AnapRS
Plasmid#140019PurposePlasmid with 4xEcoLeuT(CUA) cassette and E. coli AnapRS for amber suppression and incorporation of the fluorescent ncAA Anap; for transient or stable piggyBac-mediated integrationDepositorInsertEcoLeuRS (AnapRS)
UseTagsExpressionMammalianMutationL38F, M40G, L41P, Y499V, Y500L, Y527A, H537E, L53…PromoterEF1Available sinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only