We narrowed to 5,988 results for: crispr cas9 expression plasmids
-
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_nat
Plasmid#184918PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_nat recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_mic
Plasmid#184920PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_mic recombines in vivo with a PCR product from pEasyG3_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_zeo
Plasmid#184913PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_zeo recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_nat
Plasmid#184914PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_nat recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_hph
Plasmid#184915PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_hph recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_mic
Plasmid#184916PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_mic recombines in vivo with a PCR product from pEasyG2_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_zeo
Plasmid#184917PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_zeo recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pARNTL.1.0-gDNA
Plasmid#112480PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ARNTLDepositorInsertARNTL (BMAL1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHEY1.1.0-gDNA
Plasmid#112393PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor HEY1DepositorInsertHEY1 (HEY1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2C.1.0-gDNA
Plasmid#113792PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2CDepositorInsertTFAP2C (TFAP2C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDDIT3.1.0-gDNA
Plasmid#112396PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor DDIT3DepositorInsertDDIT3 (DDIT3 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA2 TKIT
Plasmid#169442PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA1 TKIT
Plasmid#169441PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX856
Plasmid#62888PurposeC-term SpCas9 piece of inducible transcriptional activator (dCas9(C)-FKBP-2xNLS-VP64)DepositorInsertSpCas9 (aa536-1368)
UseCRISPRTagsFKBP12, NLS, NLS SV40, and VP64ExpressionMammalianMutationAsparagine 863 to Alanine (N863A)PromoterCBhAvailable sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX855
Plasmid#62887PurposeN-term SpCas9 piece of inducible transcriptional activator (dCas9(N)-FRB-2xNES)DepositorInsertSpCas9 (aa 2-535)
UseCRISPRTagsFRB and NES PTK2ExpressionMammalianMutationAspartic acide 10 to Alanine (D10A)PromoterCBhAvailable sinceMarch 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDB4282
Plasmid#98701PurposeA plasmid containing the 3' portion of the ura4 marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-ura4 systemDepositorInsertgRNA PCR template
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDB4283
Plasmid#98702PurposeA plasmid containing the 3' portion of the bsdMX marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-bsdMX systemDepositorInsertgRNA PCR template
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMLS234
Plasmid#73682PurposeSapTrap 3-site Destination vector for N-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormMutationPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-NLS-Geo_st
Plasmid#87703PurposeExpression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP and SV40 NLSDepositorInsertGeoCas9
UseTags10xHis-MBP-TEVExpressionBacterialMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorInsertKAE1 gRNA (KAE1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorInsertSAM50 gRNA (SAM50 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorInsertARB1 gRNA (ARB1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorInsertRER2 gRNA (RER2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorInsertLEU2 gRNA (RER2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorInsertURA3 gRNA (URA3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorInsertURA3 gRNA (URA3 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorInsertAVO1 gRNA (AVO1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorInsertYFR054C gRNA (YFR054C Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorInsertZIM17 gRNA (ZIM17 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorInsertSRP14 gRNA (SRP14 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorInsertTLG1 gRNA (TLG1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorInsertVHT1 gRNA (VHT1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorInsertADE13 gRNA (ADE13 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorInsertLAS17 gRNA (LAS17 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorInsertLEU2 gRNA (LEU2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorInsertINO80 gRNA (INO80 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRGEB33
Plasmid#158151PurposeConstruction of inPTG-Cas9 plasmids expressing gRNA within an engineered intron for binary vector plant genome editing.DepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000563266)
Plasmid#80036Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only