We narrowed to 4,784 results for: AAT
-
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PKM gRNA (BRDN0001145396)
Plasmid#77633Purpose3rd generation lentiviral gRNA plasmid targeting human PKMDepositorInsertPKM (PKM Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKM gRNA (BRDN0001162243)
Plasmid#77634Purpose3rd generation lentiviral gRNA plasmid targeting human PKMDepositorInsertPKM (PKM Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterhU6 and hU6-2xTetOAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DDX3X-ts3
Plasmid#174237PurposeDDX3X knockdownDepositorInsertDDX3X shRNA (DDX3X Human)
UseLentiviral and RNAiTagsExpressionMutationPromoterSFFVAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCM2(FL)_pET49b
Plasmid#224066PurposeBacterial expression of full-length CCM2 fused to an N-terminal GST. HRV-3C cleavage siteDepositorInsertccm2 (CCM2 Human)
UseTagsGST; 6xHISExpressionBacterialMutationPromoterT7Available sinceAug. 26, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX330_TFAP2C_cterm
Plasmid#222916PurposeCas9/sgRNA plasmid for targeting TFAP2CDepositorInsertCas9, TFAP2C sgRNA (TFAP2C Human, Synthetic)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-CCND1shRNA3
Plasmid#220579PurposeTo inducibly knockdown CCND1 expressionDepositorInsertCCND1 shRNA3 (CCND1 Human)
UseLentiviralTagsExpressionMutationPromoterTRE3G (TetOP) promoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ZNF649_5-1)-PGKpuroBFP-W
Plasmid#212000PurposeExpress gRNA against ZNF649 with puro and BFPDepositorInsertsgRNA targeting ZNF649 (ZNF649 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro-shTAL1
Plasmid#210640PurposeKnockdown of TAL1 endogenous (3'UTR)DepositorInsertTAL1 3' UTR gRNA (TAL1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCM2_d410-444_eGFP
Plasmid#208877PurposeExpress eGFP-CCM2 lacking amino acids 410-444 in mammalian cells.DepositorInsertCCM2 (CCM2 Human)
UseTagseGFPExpressionMammalianMutationamino acids deletion : 410-444PromoterAvailable sinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS13-Tps2/Gsy1
Plasmid#196613PurposeEncoding guide RNAs for the knock out of TPS2 and GSY1 genesDepositorUseTagsExpressionYeastMutationPromoterSNR52Available sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#1/Cre
Plasmid#193235PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorInsertsgRunx1t1#1 (Runx1t1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-SPN_ARR Q37A/R38A/N52R (Shank3)
Plasmid#175256PurposeSPN-ARR fragment with structure opening N52R and actin binding site Q37A/R38A mutations in EGFP backbone for mammalian expressionDepositorInsertSPN-ARR fragment with Q37A/R38A/N52R mutations from SHANK3
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g3 (BB24)
Plasmid#139459PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralTagsExpressionMammalianMutationPromoterEF-1a / U6Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_1
Plasmid#155069PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_1
Plasmid#155081PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only