We narrowed to 1,209 results for: proc.2
-
Plasmid#79562Purposeexpression of CRY2PHR fused to inositol 5-phosphatase domain of human INPP5E with mutated C-terminal CaaX-motifDepositorInsertINPP5E (INPP5E Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationC-terminal region, aa 214_644, C641A mutation to …PromoterCMVAvailable sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-Acsm2
Plasmid#48158Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorInsert5" UTR of Acsm2 (Acsm2 Mouse)
UseLuciferaseAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
CRY2-INPP5E(D556A)
Plasmid#79564Purposeexpression of CRY2PHR fused to catalytically dead INPP5EDepositorInsertINPP5E (INPP5E Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationC-terminal region, aa 214_644, C641A mutation to …PromoterCMVAvailable sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pg50-2.11 (#65)
Plasmid#35966DepositorInsertTie2 promoter-1st exon-1st intron
Available sinceJuly 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCJ210
Plasmid#162683PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating S136C, G489C, S530C, and a sequence Tyr75:Phe104 to introduce a 6th and 7th disulfide bond as in AoFaeB-2.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationS136C, G489C, S530C, and a sequence Y75-F104 to i…PromoterT7/lacAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
OPEN-HLA-B*07:02-BirA
Plasmid#239752PurposeE. coli expression of BirA tagged HLA-B*07:02 containing a cysteine mutation for disulfide linkage to mutant beta-2 microglobulinDepositorInsertOPEN-HLA-B*07:02 (HLA-B Human)
TagsBirA substrate peptideExpressionBacterialMutationG120CPromoterT7Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
OPEN-HLA-A*11:01-BirA
Plasmid#235135PurposeE. coli expression of BirA tagged HLA-A*11:01 containing a cysteine mutation for disulfide linkage to mutant beta-2 microglobulin.DepositorAvailable sinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHSP90(G97D)-mOFP
Plasmid#228195Purposeexpressed human Hsp90 (G97D mutation) with a mOFP fluorescent protein tagDepositorInsertHSP90AA1(G97D) (HSP90AA1 Human)
TagsmOFPExpressionMammalianMutationG97D mutationPromoterCMVAvailable sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-21a-GFP-Patronin CC 534–868
Plasmid#59054Purposefor E. coli expression of Patronin CC truncationDepositorAvailable sinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CRY2-INPP5E(D556A)
Plasmid#79563Purposeexpression of mCherry-tagged CRY2PHR fused to catalytically dead INPP5EDepositorInsertINPP5E (INPP5E Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationC-terminal region, aa 214_644, C641A mutation to …PromoterCMVAvailable sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCZGY1026 COX8aN::miniSOG in pENTR[1-2]
Plasmid#66752PurposeminiSOG fused to N terminal 29 aa of human Cox8a for targeting to the mitochondriaDepositorInsertminiSOG
TagsCOx8aN (N terminal 29 aa)ExpressionWormAvailable sinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRG304-Ndk
Plasmid#99072PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea Ndk (nou darake)DepositorInsertNdk (nou darake) in situ probe
UseT/a cloning vector for dsrna generation and the g…Available sinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hERG1a T623A
Plasmid#53055PurposeExpresses alpha subunit of T623A hERG1a K channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily H member 2 (KCNH2 Human)
UseXenopus oocyte expressionMutationchanged Threonine 623 to AlaninePromoterSP6Available sinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRB117.2
Plasmid#181949PurposeaTc-inducible expression of NarL with N-terminal mNeonGreen fusion. Also contains mCherry under NarL-controlled promoter PdcuSDepositorInsertTagsmNeonGreenExpressionBacterialMutationSee Depositor Comments BelowPromotermNG-NarL-PLtetO-1; mCherry-PdcuS; tetR-J23106Available sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRRG227-Wnt1
Plasmid#99073PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea Wnt1 (also known as WntP-1)DepositorInsertWnt1 (also known as WntP-1) in situ probe
UseT/a cloning vector for dsrna generation and the g…Available sinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNH11 (pmyo-2::Arch(D95N)::2xMycTag)
Plasmid#130275PurposeExpresses the voltage sensor Arch(D95N) in the pharynx of C. elegans.DepositorInsertArch(D95N)
Tags2x Myc-tagExpressionWormAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTYB3-human PUM1-HD MUT3-2 (C935S-Q939E)-intein-CBD
Plasmid#73302PurposeExpresses mutant human PUM1-HDDepositorInserthuman PUM1 Pumilio homology domain (PUM1 Human)
TagsinteinExpressionBacterialMutationC935S-Q939EAvailable sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Djun - sense
Plasmid#38337DepositorAvailable sinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNH12 (pmyo-2::MacQ::mCitrine)
Plasmid#130274PurposeExpresses the eFRET-based voltage sensor MacQ::mCitrine in the pharynx of C. elegans.DepositorInsertMacQ::mCitrine
TagsmCitrineExpressionWormAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only