We narrowed to 1,647 results for: Tyr
-
Plasmid#176073PurposeEGFP fused to the C-terminus of a WWE domain containing the mutation Tyr107Ala & a hygromycin resistance cassetteDepositorInsertLivePAR (Y107A)
UseLentiviralTagsEGFPExpressionMammalianMutationPoint mutation to convert Try107 to AlaPromoterEF1AAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A-2A-mCherry
Plasmid#118272PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationPromoterCMV with beta global intronAvailable sinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EphrinB3-Flag
Plasmid#155012PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EphrinB3 from pcDNA3.1DepositorInsertEphrinB3 (EPHB3 Human)
UseTagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationPromoterCMVAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCOTS-pyl-GFP(35TAG)
Plasmid#92047PurposeThis is a S. elongatus (PCC7942) cyanobacterial plasmid that encodes the pylRS orthogonal translation system. In addition it encodes for a GFP reporter with TAG mutation at site 35.DepositorInsertsEGFP
Pyrrolysyl tRNA(cua)
Pyrrolysyl tRNA synthetase (methanosarcina mazei)
UseReplicative expression plasmid for cyanobacteria …TagsHistagExpressionMutationTyrosine in position 35 of the GFP was mutated f…PromoterLeuP (native S. elongatus promoter), PpsbII, and …Available sinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CLK1
Plasmid#174088PurposeInducibly expresses Myc-CLK1 in mammalian cells with the Tet-on systemDepositorInsertCLK1 (CLK1 Human)
UseLentiviralTagsMyc-GSSSExpressionMammalianMutationPromoterTREtightAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tet-myr-CSK K222R-GFP
Plasmid#83471PurposeLentiviral vector for doxycycline-inducible expression of membrane targeted kinase dead CSK in mammalian cellsDepositorInsertCSK (CSK Human)
UseLentiviralTagsEGFPExpressionMammalianMutationK222R (kinase dead)Promoterdoxycycline-inducible promoterAvailable sinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EphB3-Fc
Plasmid#200985PurposeMammalian expression plasmid for soluble EphB3 fused to IgG1 FcDepositorInsertEphB3 (EPHB3 Human)
UseTagsFc region of human IgG1ExpressionMammalianMutationSoluble ectodomain of EphB3PromoterCMVAvailable sinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-trkB.DN-mCherry
Plasmid#121502PurposeExpresses trkB.T1 fused with mCherry in a cre dependent manner.DepositorInserttrkB.T1 (Ntrk2 Rat)
UseAAV and Cre/LoxTagsmCherryExpressionMammalianMutationPromoterEF1aAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV 3xFLAG-GABARAPL1-GFP
Plasmid#123112PurposeExpresses 3xFLAG-GABARAPL1-EGFP in mammalian cells, for monitoring ATG4 activity towards GABARAPL1DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseTags3xFLAG and EGFPExpressionMammalianMutationPromoterCMVAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV 3xFLAG-GABARAPL2-GFP
Plasmid#123113PurposeExpresses 3xFLAG-GABARAPL2-EGFP in mammalian cells, for monitoring ATG4 activity towards GABARAPL2DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
UseTags3xFLAG and EGFPExpressionMammalianMutationPromoterCMVAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-GABARAPL2 G116
Plasmid#123105PurposeExpresses 3xFLAG-GABARAPL2 G116 in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
UseTags3xFLAGExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterCMVAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCI-Myc3-HPS4
Plasmid#133931PurposeExpresses 3xMyc-HPS4 construct in mammalian cellsDepositorInsertHPS4 (HPS4 Human)
UseTags3xMyc tagExpressionMammalianMutationGlutamic acid 229 to Glycine; Valine 552 to Methi…PromoterCMV I.E.Available sinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
G-GECO1.2-Orai1Y80E
Plasmid#73565PurposeGreen fluorescent reporter of mutant Orai1Y80E-associated calcium influxDepositorInsertG-GECO1.2-Orai1Y80E (ORAI1 Synthetic, Human)
UseTagsG-GECO1.2ExpressionMammalianMutationchanged tyrosine 80 of Orai1 to glutamatePromoterCMV Immediate EarlyAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-SOX17E57Y
Plasmid#216195PurposeGenerate lentiviruses encoding for human SOX17E57Y (HMG box numbering); for use in pluripotency reprogrammingDepositorInsertSOX17 (SOX17 Human)
UseLentiviralTagsExpressionMutationGlu113Glu (silent mutation); Glu120Glu (silent mu…PromoterAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC4 CD H976Y
Plasmid#224250PurposeExpresses human KDAC4 (HDAC4) catalytic domain H976Y in E. coliDepositorInsertKDAC4 (HDAC4 Human)
UseTagsTEV-cleavable His6ExpressionBacterialMutationOnly includes residues 648-1083 (catalytic domain…PromoterT5Available sinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
TDP-43 _CTD_5M→Y_IDR
Plasmid#194266PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with 5 Methionines to tyrosineDepositorInsertTDP-43 (TARDBP Synthetic, Human)
UseTags6XHistagExpressionBacterialMutationM307Y, M311Y, M359Y, M405Y, M414Y mutations in TD…PromoterT7Available sinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-SHMY-A1Pi
Plasmid#182648PurposeMammalian expression vector encoding a protein fusion composed of an N-terminal ER targeting sequence of hemagglutinin (HA), one tyrosine sulfation (TS) motif (Y), myc (M), His6 (H) and A1Pi sequenceDepositorInsertA1Pi (SERPINA1 Human)
UseRetroviralTagsHis6-tag, N-terminal ER targeting sequence of hem…ExpressionMammalianMutationPromoterCMVAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only