We narrowed to 11,805 results for: nsf
-
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iEscSnFR_ER
Plasmid#182818PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_ER
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iEscSnFR_PM
Plasmid#182819PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_PM
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iEscSnFR_cyto
Plasmid#182820PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_cyto
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iFluoxSnFR_ER
Plasmid#182821PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_ER
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iFluoxSnFR_PM
Plasmid#182822PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_PM
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iFluoxSnFR_cyto
Plasmid#182823PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_cyto
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-dnVamp3-P2AT2A-EGFP-caax
Plasmid#190154PurposeExpresses dominant-negative Vamp3 (rat Vamp3 AA 1-81) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp3 (Vamp2 Rat)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only rat Vamp3 AA #1-81PromoterMBPAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shTgm5-1
Plasmid#180394PurposeProducing AAV that encodes mouse Tgm5 shRNA-1 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shTgm5-2
Plasmid#180395PurposeProducing AAV that encodes mouse Tgm5 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shTgm5-3
Plasmid#180396PurposeProducing AAV that encodes mouse Tgm5 shRNA-3 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGW02 AAV-TBG-Cre-sgP53-sgRNA
Plasmid#192162PurposeAAV-TBG-Cre-sgP53-sgRNADepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TetO(3G)-GCaMP6f-WPRE
Plasmid#186205PurposeExpress GCaMP6f under TetO(3G)DepositorInsertGCaMP6f
UseAAVTags6xHis (N terminal on insert), T7 epitope, and Xpr…PromoterTetO(3G)Available SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-SynaptoZip
Plasmid#177318PurposeAAV expression of the synaptic activity-marker SynaptoZip fused to mCherry driven by human Synapsin promoterDepositorInsertmCherry-SynaptoZip (Vamp2 Rat)
UseAAVTagsMyc and mCherryExpressionMammalianPromoterhSynAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQC V5 mKO2 HuR.wt IRES Puro
Plasmid#110387Purposeγ-Retroviral transfer vector for expressing HuR (wild type), V5 and mKO2 tags, IRES-driven Puromycin selection.DepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsV5 and mKO2ExpressionMammalianPromoterCMVAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGreenII 0229/ProRUBY:GOXL6-Citrine:NOSt
Plasmid#175568PurposepSOUP helper plasmid needed for Agrobacterium-mediated plant transformation - Expression of GOXL genes tagged with Citrine under RUBY promoter for transgene complementation of ruby-6DepositorInsertGOXL6
TagsCitrineExpressionPlantPromoterRUBYAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.4.hSyn.flex.H2B.RFP
Plasmid#170386PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.flex.H2B.RFP
Plasmid#170374PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.flex.H2B.RFP
Plasmid#170376PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only