We narrowed to 6,816 results for: hwa
-
Plasmid#84982PurposeIsopentenol productionDepositorInsertMevTo-T21-MK-aphA
ExpressionBacterialPromoterLacUV5Available SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-6XDSR
Plasmid#48980Purposefor Cre-lox cassette exchange of untagged gene sequences together with 6 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-4XDSR
Plasmid#48978Purposefor Cre-lox cassette exchange of untagged gene sequences together with 4 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxAvailable SinceDec. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET15b-eIF4E
Plasmid#37228DepositorInserteIF4E
ExpressionBacterialPromoterT7Available SinceJuly 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
sTag-BFP
Plasmid#186903PurposeCell-free expression of soluble protein tagBFP-sfCherry11-SpyTagDepositorInsertSpyTag003-sfCherry11-tagBFP
UseSynthetic BiologyTagstagBFPAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2vegf121
Plasmid#22416DepositorInsertvegf (vegfaa Zebrafish)
UseZebrafish expressionAvailable SinceJan. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
M24 Nac>Nac
Plasmid#17174DepositorInsertnacre promoter driving nacre cDNA (mitfa Zebrafish)
Available SinceFeb. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
XE9 Xwnt-8 CSKA
Plasmid#16866DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
BB1_P_12_asn_coxA
Plasmid#90290PurposeBB1 promoter coxA gene of Aspergillus niger between FS1 and FS2DepositorInsertcoxA
ExpressionBacterialAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
BB1_L_23_syn_BsaI
Plasmid#89915PurposeLinker to construct BB1 from PCR product with FS2 and FS3 (in with BsaI, out with BbsI)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-cyEGFP
Plasmid#48988Purposefor Cre-lox cassette exchange of C-terminal yEGFP tagged gene sequences into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTagsyEGFPAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-8XDSR
Plasmid#48981Purposefor Cre-lox cassette exchange of untagged gene sequences together with 8 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-c3HA
Plasmid#48989Purposefor Cre-lox cassette exchange of C-terminal 3XHA tagged gene sequences into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTags3XHA tagAvailable SinceDec. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-3XDSR
Plasmid#48976Purposefor Cre-lox cassette exchange of untagged gene sequences together with 3 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRGM10
Plasmid#48790PurposeI-SceI DSB repair reporter cassetteDepositorInsertslacZ(I-SceI)
lacZ-deltaN
UseDsb repair reporterAvailable SinceFeb. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBD28
Plasmid#245766PurposeAllows for tiam-1::mGFP entry into Gateway VectorsDepositorInserttiam-1::mGFP
UseUnspecifiedTagsmGFPAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJC317
Plasmid#245773PurposeAllows for rac-2::mGFP entry into Gateway VectorsDepositorInsertrac-2::mGFP
UseUnspecifiedTagsmGFPAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only