We narrowed to 17,367 results for: Por
-
Plasmid#249147PurposeOverexpression of SpCas9-BFP with HNRNPK IVS3 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHNRNPK_IVS3-Cas9-TagBFP (HNRNPK S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHNRNPK IVS3 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-DDR1-F866Y-V5/HIS
Plasmid#236009Purposeexpression of the F866Y kinase defective mutant variant of human DDR1 that might be associated with lung AdenocarcinomaDepositorInserthuman DDR1-F866Y receptor tyrosine kinase, full length (DDR1 Human)
TagsV5/HisExpressionMammalianMutationF866Y substitutionPromoterCMVAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ĪNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ĪNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGTā¦Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA
Plasmid#182653PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF),tRNACUAPyl & eRF1E55D used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
mutant eukaryotic release factor 1
TagsHA tag and nuclear export signal (NES)ExpressionMammalianMutationE55D and Y306A/Y384F (AF) double mutant of Methanā¦PromoterCMV and U6Available SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ERBB2-V5/HIS
Plasmid#201103Purposeexpression of human ERBB2 receptor tyrosine kinase in mammalian cellsDepositorInserthuman ERBB2 receptor tyrosine kinase, full length, wildtype (ERBB2 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ĪNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ĪNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGTā¦Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-Basigin_iso2
Plasmid#221416PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertBasigin_iso2 (BSG Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_5SA-PolyA
Plasmid#112285PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) 5SA active mutant - serines 61, 109, 127, 164 and 397 (also known as 381 in other isoforms)DepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with 5 Serines (61, 109, 127, 1ā¦PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP13A2 WT
Plasmid#171485Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 WTDepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)
Plasmid#83841PurposeFluorescent probe for G1/S transition and M/G1 transitionDepositorUseLentiviralExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB multi-Hyg Human collagen type IV alpha 4 chain (COL4A4)
Plasmid#229771Purpose3xFlag-tagged human Col4A4 to be used with N- or C-tagged LgBiT Col4A5 and SmBiT Col4A3 in Nanobit assay systemDepositorInsertHuman collagen type IV alpha 4 chain (COL4A4) (COL4A4 Human)
Tags3xFLAGExpressionMammalianAvailable SinceMarch 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZ M2rtTA_CAGG TetON-Sox10
Plasmid#115240PurposeRMCE donor vector for inducible expression of SOX10 constitutive expression of m2rtTA (generated from plasmid #112668)DepositorInsertSOX10 (SOX10 Human)
ExpressionMammalianAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC18B1_STOP
Plasmid#161187PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC18B1 (C6orf192 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pZ:F3-P CAGGS tdTPH-F
Plasmid#112667PurposeDonor vector for FLPe recombinase-mediated cassette exchange in master cell lines created with plasmid #112666. This vector allows constitutive expression of your protein of interest.DepositorInserttdT
UseAAV; Donor plasmid for recombinase-mediated casseā¦ExpressionMammalianAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GCaMP5G
Plasmid#31788Purposea single-wavelength GCaMP3-based calcium indicator with improved response. Please also see the GCaMP6s/m/f indicators.DepositorInsertGCaMP5G
Tags6xHis, T7 epitope, and Xpress tagExpressionMammalianPromoterCMVAvailable SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
RKS-Fzd7/8 subtype NGS Wnt
Plasmid#159628PurposeExpress Fzd7/8 subtype NGS Wnt in mammalian cellsDepositorInsertFzd7/8 subtype NGS Wnt
UseLentiviralTagsHis tagExpressionMammalianAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMIH-TFAM-GFP
Plasmid#113704PurposeFluorescent fusion protein used to visualise mitochondrial nucleoids, with hygromycin selectionDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIH-TOMM20-Halo
Plasmid#111626PurposeFusion protein used to visualise mitochondria upon the addition of Halo specific dye, has hygromycin selectionDepositorAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-AML1/ETO-IRES-GFP
Plasmid#60832PurposeAML1/ETO9a cDNA was generated by PCR from full-length human AML1/ETO-IRES-GFP and subcloned into MSCV-IRES-GFPDepositorAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST-mCherry-ARHGEF2
Plasmid#207959PurposeExpression vector for ARHGEF2 (GEF-H1) with an N-terminal mCherry tagDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only