We narrowed to 11,061 results for: AGA
-
Plasmid#52009PurposeExpresses the human MAVS CDS containing the point mutation M1ADepositorInsertMAVS-M1A
UseRetroviralExpressionMammalianMutationchanged Met 1 to AlaAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-M1A500(KaganF60)
Plasmid#52003PurposeExpresses the human MAVS CDS containing a point mutation M1A and a C-terminal deletion removing the transmembrane domainDepositorInsertMAVS-M1A-500
ExpressionMammalianMutationchanged Met 1 to Ala and deleted the C-terminal t…Available SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-MAVS-M142A(KaganE19)
Plasmid#52010PurposeExpresses the human MAVS CDS containing the point mutation M142ADepositorInsertMAVS-M142A
UseRetroviralExpressionMammalianMutationchanged Met 142 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-M142A(KaganF59)
Plasmid#52062PurposeExpresses the human MAVS CDS containing the point mutation M142A "weak translational context"DepositorInsertMAVS-M142A
ExpressionMammalianMutationchanged Met 142 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-IRESWT-Gbetagamma ONE-GO
Plasmid#204339PurposeGPCR/G protein BRET biosensorDepositorInsertGbetagamma ONE-GO
UseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHACK(Gal4)-DONR(T2A-LexAGAD)
Plasmid#194769PurposeTo insert T2A-LexAGAD into Gal4 coding sequence in Drosophila, converting Gal4 into a T2A-LexAGAD transgene.DepositorInsertT2A-LexAGAD
UseCRISPRExpressionInsectAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKSB- 3xP3-YFPsv40 GGGG AAGA
Plasmid#174530Purpose3xP3-YFP fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsert3xP3-YFP BsaI cassette
ExpressionInsectPromoter3xP3Available SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIM1708-surT-PsurP-agaN-pNW33N
Plasmid#44009DepositorInsertsurT-PsurP-agaN
ExpressionBacterialMutationDeleted EcoRI site (synonymous change, C to T at …Available SinceMay 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
PX458 pSp Cas9 Rhino1 tagA
Plasmid#211627PurposeCas9 Rhino1 tagADepositorInsertRHNO tagA
ExpressionMammalianPromoterU6Available SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Agarabi CHO Heavy Chain in pJ201
Plasmid#111567PurposeCloning vector containing CDS for the modified human heavy chain of the model chimeric mouse-human IgG1 expressed by the Agarabi CHO cell lineDepositorInsertHuman heavy chain
UseSynthetic Biology; Cloning vectorPromoterNoneAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKSB- 3xP3-DsRedSV40 GGGG AAGA
Plasmid#174532Purpose3xP3-DsRed fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsert3xP3-DsRed BsaI cassette
ExpressionInsectAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB- 3xP3-mTurqSV40 GGGG AAGA
Plasmid#174533Purpose3xP3-mTurquoise fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsert3xP3-mTurquoise BsaI cassette
ExpressionInsectPromoter3xP3Available SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Agarabi CHO Light Chain in pJ201
Plasmid#111566PurposeCloning vector containing CDS for the murine light chain of the model chimeric mouse-human IgG1 expressed by the Agarabi CHO cell lineDepositorInsertMurine light chain
UseSynthetic Biology; Cloning vectorPromoterNoneAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKSB-610 U6-sgRNA2 GGAA AGAG
Plasmid#173672PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB- 3xP3-GFPsv40 GGGG AAGA
Plasmid#174531Purpose3xP3-GFP fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsert3xP3-GFP BsaI cassette
ExpressionInsectPromoter3xP3Available SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB-611U6-sgRNA3 AGAG AACA
Plasmid#173673PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-M1A-invitro(KaganE12)
Plasmid#52016PurposeUsed for in vitro expression of the human MAVS CDS containing a point mutation M1ADepositorInsertMAVS-M1A
ExpressionMammalianMutationchanged Met 1 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-G67M-invitro(KaganD100)
Plasmid#52014PurposeUsed for in vitro expression of the human MAVS CDS containing a point mutation G67MDepositorInsertMAVS
ExpressionMammalianMutationChanged Gly 67 to MetAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-L62M-invitro(KaganD98)
Plasmid#52013PurposeUsed for in vitro expression of the human MAVS CDS containing a point mutation L62MDepositorInsertMAVS
ExpressionMammalianMutationChanged Leu 62 to MetAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-E80M-invitro(KaganD99)
Plasmid#52015PurposeUsed for in vitro expression of the human MAVS CDS containing a point mutation E80MDepositorInsertMAVS
ExpressionMammalianMutationChanged Glu 80 to MetAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-α-Synuclein-c_myc
Plasmid#225222PurposeYeast optimized human alpha synuclein fused with aga2 protein gene under gal1 promoter for the expression of alpha synuclein in yeast surface display.DepositorInsertsα-Synuclein
Aga2
TagsGS linker, HA Tag, and c-myc TagExpressionYeastPromoterGAL1Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCTCON2-Aga2p-Flag-CapN-TEVcs-HA
Plasmid#213530PurposeExpresses CapN-caged TEVcs on yeast surfaceDepositorInsertAga2p-Flag-CapN-TEVcs-HA
ExpressionYeastPromoterGal1/10Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBac{3Xtin-GAGA-eGFP,w+,attB}
Plasmid#182195PurposeEGFP driven by tinman and GAGA transcription factor binding sitesDepositorInsertEGFP
ExpressionInsectAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKSB- PUb-NLSmTurqSV40 GGGG AAGA
Plasmid#174535PurposePUb-mTurquoise fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsertPUb-mTurquoise BsaI cassette
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB- PUb-GFPsv40 GGGG AAGA
Plasmid#174536PurposePUb-GFP fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsertPUb-GFP-SV40 BsaI cassette
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB- PUb-GFPTub56D GGGG AAGA
Plasmid#174537PurposePUb-GFP fluorescence marker cassette for gene knock-in in mosquitoes, with DmTub56D terminatorDepositorInsertPUb-GFP-Tub56Dterminator BsaI cassette
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB- PUb-DsRedSV40 GGGG AAGA
Plasmid#174538PurposePUb-DsRed fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsertPUb-DsRed BsaI cassette
ExpressionInsectPromoterAedes aegypti PolyubiquitinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMK-rps2 5'UTR mAAGA (-20 to -10 deletion)
Plasmid#123535PurposeMoChlo kitDepositorInsertrps2 5'UTR mAAGA (-20 to -10 deletion)
UseSynthetic BiologyAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_ORI_AGAP1
Plasmid#99300PurposeLuciferase validation vector with AGAP1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr2: 236735694-236737193 (AGAP1 Human)
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_AGAP1
Plasmid#99301PurposeLuciferase validation vector with AGAP1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr2: 236735694-236737193 (AGAP1 Human)
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_SCP1_AGAP1
Plasmid#99302PurposeLuciferase validation vector with AGAP1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr2: 236735694-236737193 (AGAP1 Human)
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-HA-shift-IRES-GFP(KaganE21)
Plasmid#52004PurposeExpresses the human MAVS CDS containing an N-terminal HA tag and a frameshift mutation inserting TA at bp number 254 of the MAVS CDS . And a GFP markerDepositorInsertMAVS-Shift
UseRetroviralTagsHAExpressionMammalianMutationA 2 nucleotide insertion was introduced between t…Available SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-5'UTR-MAVS-ORF3,4(KaganE50)
Plasmid#52007PurposeExpresses the human MAVS CDS and contains the 5'UTR sequence with a mutation in the start codons 61 and 67 nt downstream of the FL MAVS start codonDepositorInsert5utr-MAVS-ORF2,3mut
ExpressionMammalianMutationmutated start codons for ORF3 and 4Available SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-M1A,M142A(KaganF62)
Plasmid#52002PurposeExpresses the human MAVS CDS containing two point mutations M1A and M142ADepositorInsertMAVS
ExpressionMammalianMutationchanged Met 1 to Ala and Met 142 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-5'UTR-MAVS-ORF1(KaganE49)
Plasmid#52006PurposeExpresses the human MAVS CDS and contains the 5'UTR sequence with a mutation in the start codon 37 nt upstream of the FL MAVS start codonDepositorInsert5utr-MAVS-ORF1mut
ExpressionMammalianMutationmutation removing the start codon for ORF1Available SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-MAVS-M1A,M142A(KaganE20)
Plasmid#52011PurposeExpresses the human MAVS CDS containing the point mutations M1A and M142ADepositorInsertMAVS-M1A,M142A
UseRetroviralExpressionMammalianMutationchanged Met 1 to Ala and Met 142 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Galpha-i3-IRESWT-Gbetagamma ONE-GO
Plasmid#204341PurposeGPCR/G protein BRET biosensorDepositorInsertGalpha-i3/Gbetagamma ONE-GO
UseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVX-CMV-Galpha-s-IRESWT-Gbetagamma ONE-GO
Plasmid#204340PurposeGPCR/G protein BRET biosensorDepositorInsertGalpha-s/Gbetagamma ONE-GO
UseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVX-hSyn-Galpha-i3-IRESWT-Gbetagamma ONE-GO
Plasmid#204343PurposeGPCR/G protein BRET biosensorDepositorInserthSyn Galpha-i3/Gbetagamma ONE-GO
UseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVX-hSyn-Galpha-s-IRESWT-Gbetagamma ONE-GO
Plasmid#204342PurposeGPCR/G protein BRET biosensorDepositorInserthSyn Galpha-s/Gbetagamma ONE-GO
UseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAG306-pTet07-synYFP[TTG/AGA]-nLuc
Plasmid#199756PurposeElongation reporter construct to quantify elongation of synYFP[TTG]; Control construct of elongation reporter to quantify elongation duration of n_CGA stallingDepositorInsertsynYFP[TTG/AGA]-nLuc
ExpressionYeastPromoterTetO7Available SinceMay 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Amyloid β42-c_myc
Plasmid#225223PurposeYeast optimized human Amyloid β42 fused with aga2 protein gene under gal1 promoter for the expression of Amyloid β42 in yeast surface display.DepositorInsertsTagsHA Tag and c-myc TagExpressionYeastPromoterGAL1Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Htt(25Q)-c_myc
Plasmid#225228PurposeYeast optimized human Htt (25Q) fused with aga2 protein gene under gal1 promoter for the expression of Htt (25Q) in yeast surface display.DepositorInsertsAga2
Htt (25Q)
TagsHA Tag and c-myc TagExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Htt(46Q)-c_myc
Plasmid#225229PurposeYeast optimized human Htt (46Q) fused with aga2 protein gene under gal1 promoter for the expression of Htt (46Q) in yeast surface display.DepositorInsertsAga2
Htt (46Q)
TagsHA Tag and c-myc TagExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKSB- attP 3xP3-GFPsv40 GGGG AAGA
Plasmid#174534PurposeattP site and 3xP3-GFP fluorescence marker cassette for gene knock-in in mosquitoesDepositorInsertattP and 3xP3-GFP-SV40 BsaI cassette
ExpressionInsectPromoter3xP3Available SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-M1A,M142A-invitro(KaganE14)
Plasmid#52018PurposeUsed for in vitro expression of the human MAVS CDS containing the point mutations M1A,M142ADepositorInsertMAVS-M1A,M142A
ExpressionMammalianMutationchanged Met 1 to Ala and Met 142 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Spike-deltaC18 T478R (AGA)
Plasmid#212533PurposeEncodes SARS-CoV-2 spike T478R for pseudovirus productionDepositorInsertSARS-CoV-2 Spike T478R (S Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationT478RPromoterCAGAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Spike-deltaC18 T19R (AGA)
Plasmid#212417PurposeEncodes SARS-CoV-2 spike T19R for pseudovirus productionDepositorInsertSARS-CoV-2 Spike T19R (S Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationT19RPromoterCAGAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-synYFP[TTG/AGA]-4xArg[CGA]-nLuc
Plasmid#199759PurposeElongation reporter construct to quantify elongation duration of 4_CGA stallingDepositorInsertsynYFP[TTG/AGA]-4xArg[CGA]-nLuc
ExpressionYeastPromoterTetO7Available SinceMay 25, 2023AvailabilityAcademic Institutions and Nonprofits only