We narrowed to 104 results for: crispr cas9 vector px330
-
Plasmid#254042PurposeExpress SpCas9 and two gRNAs: UGT1 and LP400~3pDepositorInsertUGT1 + LP400~3p
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova)
Plasmid#85041PurposeThis plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9.DepositorInsertloxP-stop-loxP
UseCRISPRExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-Cas9
Plasmid#135010PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9DepositorInserthumanized S. pyogenes Cas9
Tags3xFLAG (N terminal on insert)ExpressionMammalianPromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry
Plasmid#64324PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianPromoterCBh and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP
Plasmid#64323PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to BFP via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-EBFP2ExpressionMammalianPromoterCBh and U6Available SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196078Purpose(Empty Backbone) Constitutive CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196076Purpose(Empty Backbone) Constitutive CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196074Purpose(Empty Backbone) Constitutive CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196084Purpose(Empty Backbone) Inducible CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196080Purpose(Empty Backbone) Inducible CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Blasticidin S deaminase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-Cas9-T2A-mCherry
Plasmid#135012PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianPromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA
Plasmid#86613PurposeVector for tandem expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9
Plasmid#135011PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9DepositorInserthumanized S. pyogenes Cas9
Tags126aa domain from HSV-1 UL12 fused to the N-termi…ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UC-Cas9-T2A-mCherry
Plasmid#135014PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to C-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the C-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9-T2A-mCherry
Plasmid#135013PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
Plasmid#83306PurposeLentivirus vector to express guideRNA and dCas9 with puro resistant geneDepositorInsertsgRNA and dCas9 from pX330
UseLentiviralTagsFLAG and PA tagsExpressionMammalianPromoterU6 for sgRNA and CBh for dCas9Available SinceDec. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDG330
Plasmid#100898PurposeSpCas9 with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAGExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only