We narrowed to 2,167 results for: CO
-
Plasmid#105032PurposeLentiviral gRNA plasmid targeting mouse Hgs , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only
-
M3K5_HUMAN_D0
Plasmid#79710PurposeThis plasmid encodes the kinase domain of M3K5. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
E2AK2_HUMAN_D0
Plasmid#79712PurposeThis plasmid encodes the kinase domain of E2AK2. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSKP_HUMAN_D0
Plasmid#79714PurposeThis plasmid encodes the kinase domain of CSKP. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
DMPK_HUMAN_D0
Plasmid#79717PurposeThis plasmid encodes the kinase domain of DMPK. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
KC1G1_HUMAN_D0
Plasmid#79691PurposeThis plasmid encodes the kinase domain of KC1G1. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSK22_HUMAN_D0
Plasmid#79704PurposeThis plasmid encodes the kinase domain of CSK22. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-RGS7t
Plasmid#55761PurposeAn amino-terminal CFP Fragment was fused to residues 202-477 of RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertRGS7(202-477)-CFP(1-158) (RGS7 Human, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationThe RGS sequence amino terminal to the GGL domain…PromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT7_SEPT9_i1-TEV-Strep
Plasmid#174500Purposebacterial co-expression of human SEPT7 and of human SEPT9_i1DepositorAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT-Lyn11-mEGFP-cpHalo∆-(GGS)9-FKBP-P2A-Hpep3-(GGS)3-FRB-mScarlett
Plasmid#205703PurposeCMV driven co-expression of split HaloTag FKBP- and FRB-fusions (Lyn11-EGFP-FKBP-cpHalo∆ and Hpep1-FRB-mScarlett) in mammalian cell linesDepositorInsertLyn11-EGFP-FKBP-cpHalo∆-P2A-Hpep1-FRB-mScarlett
ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-SB
Plasmid#177936PurposeExpresses SpCas9 and sgRNA. Can be integrated into the genome upon co-delivery of Sleeping Beauty transposase.DepositorTypeEmpty backboneUseCRISPR; TransposonExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (IRES-GFP)
Plasmid#85181PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interaction. Co-expresses EGFP for selectionDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBT2-4xUAS:NICD-P2A-mRFP
Plasmid#127594PurposeZebrafish NICD was driven by 4xnrUAS, to be co-expressed with mRFP through P2A self-cleaving peptides.DepositorInsertNICD (notch1a Zebrafish)
UseZebrafish expressionAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pF1-Hs Cdk1/cyclin B1
Plasmid#177330PurposeCo-expression of the human active Cdk1/cyclin B1 kinase complexDepositorTags2 x Strep-tag and 8 x HisExpressionInsectAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-FLAG-KORD-P2A-ArgiNLS-AausFP1
Plasmid#220612PurposeCre-dependent co-expression of FLAG-tagged inhibitory KORD DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-KORD-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-KORD-P2A-3xHA-hM3D(Gq)
Plasmid#220611PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory KORD DREADD receptor, and 3x HA-tagged excitatory hM3D(Gq) DREADD receptor.DepositorInsertFLAG-KORD-P2A-3x HA-hM3D(Gq)
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterhSynAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT6_SEPT7-TEV-Strep
Plasmid#174499Purposebacterial co-expression of human SEPT6 and of human SEPT7DepositorAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-KORD-P2A-ArgiNLS-AausFP1
Plasmid#220610PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory KORD DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporterDepositorInsertFLAG-KORD-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterhSynAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2_SEPT6
Plasmid#174497Purposebacterial co-expression of human SEPT2 and of human SEPT6DepositorAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-FLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
Plasmid#220613PurposeCre-dependent co-expression of FLAG-tagged inhibitory hM4D(Gi) DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterEF1aAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-3xHA-hM3D(Gq)-P2A-ArgiNLS-oScarlet
Plasmid#220614PurposeCre-dependent co-expression of 3x HA-tagged excitatory hM3D(Gq) DREADD receptor, and a single-cell discriminating version of oScarlet as a reporter.DepositorInsert3x HA-hM3D(Gq)-P2A-AgiNLS-oScarlet
UseAAV and Cre/LoxTags3x HA; ArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF-FH-TAZ S89A-ires-blast
Plasmid#52084PurposeLentiviral expression vector for TAZ S89A mutant with N-terminal FLAG and His tagsDepositorInsertTAZ S89A (WWTR1 Human)
UseLentiviralTagsFLAG and HisExpressionMammalianMutationS89APromoterEF1aAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF-FH-TAZ-ires-blast
Plasmid#52083PurposeLentiviral expression vector for TAZ with N-terminal FLAG and His tagsDepositorAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+CMV-Ins-GLuc
Plasmid#89929PurposeExpresses Insulin-GLuc from the CMV promoter. Gaussia Luc is inserted within the C-peptide and is co-secreted with insulin.DepositorInserthuman insulin-Gaussia-Luciferase (INS Human, Synthetic)
ExpressionMammalianMutationDNA sequence for Gaussia luciferase was humanized…PromoterCMVAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT7_SEPT9_i5-TEV-Strep
Plasmid#174502Purposebacterial co-expression of human SEPT7 and of human SEPT9_i5DepositorAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-TFIIE
Plasmid#171083PurposeCo-expresses human TFIIE. The resulting plasmid was used to generate a single expression construct encoding 2 subunits, with His-tag on TF2E1.Originally from MN Gonzalez, was submitted with permissionDepositorTagsHisExpressionBacterialPromoterT7 promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-msfGFP_SEPT6
Plasmid#174498Purposebacterial co-expression of human SEPT2 fused to monomeric superfolder GFP and of human SEPT6DepositorTagsHis6-TEV and msfGFPExpressionBacterialAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT7_SEPT9_i3-TEV-Strep
Plasmid#174501Purposebacterial co-expression of human SEPT7 and of human SEPT9_i3DepositorAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(milli)-BoNT/B(147-441, Y365A)
Plasmid#122985PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(milli)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(milli)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains A58V,R73Q "milli" mutatio…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2AmCherry-W
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
FGFR1_HUMAN_D0
Plasmid#79719PurposeThis plasmid encodes the kinase domain of FGFR1. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
Plasmid#163176PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-3xHA-hM3D(Gq)-P2A-ArgiNLS-oScarlet
Plasmid#220608PurposeNeuron-specific, Cre-dependent co-expression of 3x HA-tagged excitatory hM3D(Gq) DREADD receptor, and a single-cell discriminating version of oScarlet as a reporter.DepositorInsert3x HA-hM3D(Gq)-P2A-AgiNLS-oScarlet
UseAAV and Cre/LoxTags3x HA; ArgiNLSExpressionMammalianPromoterhSynAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A)
Plasmid#122986PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(micro)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(micro)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains R73Q "micro" mutation, Bo…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Prom1-TEVp-TwinStrep-His / IRES2 / Pcdh21-TEVp-Myc-Flag
Plasmid#210820PurposeMammalian overexpression vector for polycistronic co-expression of C-terminally Strep and His tagged human Prom1s1 (WT) and C-terminally Myc and Flag tagged human Pchd21 (WT)DepositorTagsMyc, 3xFlag and TwinStrep, 10xHisExpressionMammalianPromoterCMV and CMV / IRES2Available SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2AmCherry-W
Plasmid#163177PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-beta-5 in pcDNAI/Amp
Plasmid#55708PurposeAn amino-terminal fragment of mCerulean was fused to Gbeta5. When co-expressed with a carboxyl terminal CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertmCer(1-158)-beta5 (GNB5 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-5 was amplified via PCR, which added an N-t…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2ABFP-W
Plasmid#163178PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only