We narrowed to 14,762 results for: RING
-
Plasmid#236121PurposeFuorescent reporter encoding H2B-tagBFP fusion under control of E1b minimal promoter with four Gal4-binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsmTagBFP2ExpressionMammalianPromoterE1b minimal promoter with four Gal4-binding sites…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC49-puro
Plasmid#231989PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG eGFP NLS
Plasmid#170830PurposeDonor plasmid for knocking eGFP NLS into AAVS1 safe harbor locusDepositorInserteGFP
UseCRISPR, Synthetic Biology, and TALENTagsNLSExpressionMammalianPromoterCAGAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
nuc-GafD-mTurboID-HA
Plasmid#184641PurposeExpresses 3xHA-tagged GlycoID construct: GafD_short-miniTurboID in mammalian nucleus for O-GlcNAc interactome taggingDepositorInsertnuc-GlycoID-HA
Tags3xHA tag and Nuclear localization sequenceExpressionMammalianMutationGafD -> expressed 22-178 ; BirA* -> express…PromoterCMVAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
mcherry p62 delta UBA silent
Plasmid#187984Purposemcherry p62 lacking UBA domain (aa389-434) but it has the silent mutations to be resistant to sip62. Internal reference: SMC572DepositorInsertp62 (NUP62 Human)
TagsmCherryExpressionMammalianMutationLacking UBA domain (aa389-434) but it has the sil…Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pv9_TAF3_2xPHD-13XL-BASU
Plasmid#179414PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of TAF3.2xPHD-13XL-BASUDepositorInsertTAF3.2xPHD-13XL-BASU
ExpressionMammalianPromoterCAGGSAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-mCD24-T2A-GFP
Plasmid#205448Purposelentiviral plasmid for expression of mouse CD24DepositorAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pH-Ubi-miniSdd7-nCas9-PBE
Plasmid#204856PurposeFor cytosine base editing using miniSdd7 in monocotyledon plants (Agrobacterium-mediated transformation)DepositorInsertminiSdd7-nSpCas9(D10A)-UGI
UseCRISPRExpressionPlantMutationD10A in SpCas9PromoterZmUbi-1, OsU3, 35SAvailable SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
eTd-CBEa
Plasmid#196603PurposeMammalian expression of eTd-CBEaDepositorInsertbpNLS-TadA-8e (N46L/P29A)-nSpCas9-bpNLS-P2A-UGI-bpNLS
Tags6*HisExpressionMammalianAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-YAP1
Plasmid#79503PurposeMultiSite Gateway entry clones, second fragment (attL5, attL2) Human YAP1 CDSDepositorAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV CMV mCherry-DDX21-V5
Plasmid#175163PurposeLentiviral expression of human DDX21-V5DepositorAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc
Plasmid#208382PurposeDerived from LentiCRISPRV2 by replacing Cas9 with Cre recombinase and puromycin resistance with GpNLuc. Contains a stuffer sequence for cloning of sgRNA of interest, as per LentiCRISPRV2.DepositorTypeEmpty backboneUseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:SRDX:Tnos (GB1188)
Plasmid#160608PurposeTU for the expression of the dCas9 with the repressor domain SRDX as a CT fusion (CRISPR tools)DepositorInsertP35s:dCas9:SRDX:tNOS
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNS38-SadCas9-SNAP
Plasmid#113718PurposeBacterial vector for expression of Snap-tagged Staphylococcus aureus dCas9DepositorInsertCas9
UseCRISPRTagsHA-2xNLS-SNAP-NLS and His6-MBP-TEVExpressionBacterialMutationD10A, N580AAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRY2olig-mCh-CLC
Plasmid#60035PurposeExpresses a fusion of CRY2olig (PHR, E490G) with mCherry and mouse clathrin light chainDepositorInsertCRY2-mCh-Clathrin Light Chain (CRY2 Mouse, Mustard Weed)
ExpressionMammalianMutationM354I, E490G CRY2, A9D*PromoterCMVAvailable SinceOct. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9HF1-indRecA56
Plasmid#102294PurposeModified from pEM-Cas9HF1 (Addgene ID: 89961) to co-express inducible recA56 to block recA-mediated double-strand break repair.DepositorInsertsCas9HF1
recA56
UseCRISPRExpressionBacterialMutationN497A/R661A/Q695A/Q926APromoterpTetAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
mcherry-p62 delta PB1 silent
Plasmid#187985Purposehuman p62 lacking PB1 domain (=aa1-102) with a silent mutation to get resistance for sip62 #5 (Dharmacon). Internal Reference: SMC552DepositorInsertp62 (NUP62 Human)
TagsmCherryExpressionMammalianMutationLacking PB1 domain (aa1-102) with a silent mutati…Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
SuExp His-Myc-mPLD3
Plasmid#173853PurposeProtein expression plasmid for recombinant His-Myc tag mouse PLD3DepositorInsertPLD3 (Pld3 Mouse)
Tags6xHis, Myc, Factor X cleavableExpressionMammalianMutationintracellular and transmembrane domain truncated,…PromoterCMVAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
ins:GCaMP6s; cryaa:RFP
Plasmid#110285PurposeA zebrafish insulin promoter driving the calcium indicator, GCaMP6s. Contains red eye marker, and is flanked with I-SceI sites.DepositorInsertGCaMP6s
UseZebrafishPromoterinsulinAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only