We narrowed to 2,898 results for: GFP reporter gene
-
Plasmid#169316PurposeDoxycycline-inducible expression of miR-ctrl with dTomato as reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsdTomatoPromoterTREAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.GFP.miR-ctrl
Plasmid#169305PurposeConstitutive overexpression of miR-ctrl with GFP as a reporter fluorescent proteinDepositorInsertmiR-ctrl
UseLentiviralTagsEGFPPromoterSFFVAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-H13LTat-Thy1.2-P2A-GFP-T2A-Nef
Plasmid#126553PurposeReplication incompetent HIV with H13L Tat and GFP-t2a-Thy1.2 reporterDepositorInsertHIV-1 vector pNL4-3
UseLentiviralTagsThy1.2 and GFPPromoterHIV LTRAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(H66)
Plasmid#63558PurposeExpression of the Azure (blue) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(H66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
PL-SIN-EOS-S(4+)-EGFP
Plasmid#21317PurposeLentiviral EOS reporter with Sox2 enhancer (x4), expresses EGFPDepositorInsertEnhanced Green Fluorescence Protein
UseLentiviralExpressionMammalianPromoterEOS-S(4+) promoter regionAvailable SinceJune 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
PL-SIN-EOS-C(3+)-EGFP
Plasmid#21318PurposeLentiviral EOS reporter with Oct3/4 enhancer (x3), expresses EGFPDepositorInsertEnhanced Green Fluorescence Protein
UseLentiviralExpressionMammalianPromoterEOS-C(3+) promoter regionAvailable SinceJune 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG2-QUAS5x:GFPNLS-SV40pA
Plasmid#155122PurposeTol2 vector containing QUAS5x reporter element upstream of GFP-NLS. Includes cmlc2:mRFP-SV40pA transgenesis markerDepositorInsertQUAS5x:GFPNLS
UseZebrafish expressionPromoterQUAS5x-E1bAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(Y203)
Plasmid#63559PurposeExpression of the Mostaza (yellow) spectral variant of eGFP in bacteria and in mammalian cells. Used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Y203)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged threonine at position 203 with respect to…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDH_TNF-SBP-EGFP
Plasmid#65282PurposeTNF reporter only (no hook) (RUSH system)DepositorAvailable SinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCK074 p5E exorh:EGFP
Plasmid#195951PurposeGateway p5E vector with reporterDepositorInsertexorh:EGFP
UseOtherAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
p1.1-Tr2-eGFP
Plasmid#162782PurposeFluorescent reporter for protein expression studiesDepositorInsertenhanced green fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(Stop66)
Plasmid#63218PurposeExpression of a non-sense mutant version of eGFP (dark) in bacteria and in mammalian cells. Could be used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Stop66)
UseLentiviralTagsT7 and his6ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(W66)
Plasmid#63217PurposeExpression of the Celeste (cyan) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(W66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPB-NeoCOVGT3-d2EGFP
Plasmid#201446PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT3_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-APEX.NES-P2A-EGFP
Plasmid#182824PurposeCre-dependent expression of cytosolic APEXDepositorInsertAPEX.NES-P2A-EGFP
UseAAVTagsEGFP reporter (P2A)PromoterEF1aAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-H2B.APEX-P2A-EGFP
Plasmid#182825PurposeCre-dependent expression of H2B-APEX fusionDepositorInsertH2B.APEX-P2A-EGFP
UseAAVTagsEGFP reporter (P2A)PromoterEF1aAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS315-ADH700p-yeCherry-p150-yeGFP-CYCt
Plasmid#194519PurposeDual fluorescence reporter for studying protein degradationDepositorInsertTIF4631 leader sequence
ExpressionYeastAvailable SinceFeb. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-LckAPEX-P2A-EGFP
Plasmid#182826PurposeCre-dependent expression of membrane localized APEXDepositorInsertLckAPEX-P2A-EGFP
UseAAVTagsEGFP reporter (P2A)PromoterEF1aAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHBS1292 TDP43 RRM-GFP G368W+W385G
Plasmid#107838PurposeTo test the effect of sequence on TDP43 droplet propertiesDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationG368W and W385G mutations in LLPS reporterAvailable SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only