We narrowed to 13,645 results for: sequence
-
Plasmid#132099PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC35B1 (SLC35B1 Human)
ExpressionMammalianAvailable SinceDec. 3, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
Zebrafish ArcLight Q175
Plasmid#53616PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertZebrafish ArcLight-Q175 (tpte Aequorea victoria, Zebrafish, Synthetic)
ExpressionMammalianMutationDr-VSD contains R153Q mutation and an amino acid …PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
RRL.sin.cPPT.SFFV/Flag-codon-optimized-NCOA7 variant 6.IRES-puro.WPRE (CG584)
Plasmid#139444PurposeLentiviral vector to ectopically express human codon-optimized NCOA7 isoform 4DepositorInsertFLAG-tag codon-optimized NCOA7 variant 6 (coding for isoform 4, the short, interferon-inducble isoform) (NCOA7 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationsequence codon-optimizedPromoterSFFVAvailable SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-short_BrokenHeart (no BC)
Plasmid#86950PurposeAAV transfer plasmid containing the BrokenHeart construct: a hyperpiggybac donor transposon interrupting the tdTomato fluorophore. Transposase activity rescues coding sequence.DepositorInsertBrokenheart construct
UseAAVExpressionMammalianAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K120R)
Plasmid#72554PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K120R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK120RPromoterE1B minimal promoterAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FNLS-PGK-Puro
Plasmid#110844PurposeLentiviral vector for constitutive expression of FNLS in mammalian cells (codon optimized)DepositorInsertBE3RA-FNLS
UseLentiviralTags3X FLAGMutationD10A and NLS sequence at the N-terminusPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
L1cam-Fc-His
Plasmid#72083PurposeExpresses the extracellular region of the L1CAM protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
ACTB-(A)1x
Plasmid#112055PurposeACTB mRNA tagged with 1 copy of Riboglow (variant A)DepositorInsertACTB (ACTB Human)
TagsRiboglow RNA tagExpressionMammalianMutation1 copy of Riboglow tag (variant A) after stop cod…PromoterCMVAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorHas ServiceAAV1InsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC47A1
Plasmid#132227PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC47A1 (SLC47A1 Human)
ExpressionMammalianAvailable SinceNov. 8, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR FL CPAP RNAi resistant
Plasmid#46390DepositorInsertCPAP RNAi resistant mutant (CENPJ Human)
UseEntry vectorMutationsilent mutation that renders it resistant to siRN…Available SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC19A3
Plasmid#132045PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC19A3 (SLC19A3 Human)
ExpressionMammalianAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
Donor_ANKRD1_KO_Puro
Plasmid#186667PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, puromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Puromycin (ANKRD1 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG106 Lyn11-FAST
Plasmid#130721PurposeExpresses FAST (also called YFAST) fused to Lyn11 sequence in mammalian cellsDepositorInsertlyn11-FAST
Tagsmyc-tagExpressionMammalianPromoterCMVAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-MIOS(1-875) in pRK5
Plasmid#184561PurposeCMV-driven expression of an N-terminally Flag-tagged MIOS (core subunit of GATOR2) — native sequence for transient expression in mammalian cells.DepositorAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC9B1
Plasmid#132223PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC9B1 (NHEDC1 Human)
ExpressionMammalianAvailable SinceNov. 7, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC28A3
Plasmid#132151PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC28A3 (SLC28A3 Human)
ExpressionMammalianAvailable SinceNov. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC35A3
Plasmid#132135PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC35A3 (SLC35A3 Human)
ExpressionMammalianAvailable SinceDec. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC41A1
Plasmid#132237PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC41A1 (SLC41A1 Human)
ExpressionMammalianAvailable SinceNov. 8, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits