We narrowed to 4,936 results for: AAT
-
Plasmid#68857PurposeExpresses Human CDK8 W105M MutantDepositorInsertCyclin-Dependent Kinase 8 (CDK8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationW105MPromoterEF1αAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti GW V5 Eco/Dam hum LaminB1
Plasmid#182671PurposeEukaryotic expression vector with E.Coli Dam methylation fused to human Lamin B1. Used in DamID experiments to methylate DNA that interacts in the proximity of Lamin B1.DepositorInsertLamin B1 (LMNB1 Human)
UseLentiviralTagsE. Coli Dam and V5ExpressionMammalianPromoterHSPAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSYN1-NES-OCaMP-WPRE
Plasmid#224934PurposepAAV (non-flex) for expressing OCaMP, an orange calcium indicator, in mammalian cells and in vivo. Contains hSyn promoter and RSET leader sequence peptideDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianPromoterhSynIAvailable SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
COVID-SARS2 NSP14/10
Plasmid#159613PurposeBacterial co-expression vector fo Covid-SARS2 NSP14 and NSP10DepositorInsertsTagsHis6, TEV cleavage site and noneExpressionBacterialMutationCodon-optimized for E. coli expressionPromoter(Bicistronic) and T7 - LacOAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMVblast_SLC38A2_wt
Plasmid#156180PurposeCMV-driven expression of sgRNA-resistant SLC38A2 wild-type cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA se…PromoterCMVAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-CDK19-WT-IRES-ZsGreen
Plasmid#68858PurposeExpresses Human CDK19 Wild-TypeDepositorInsertCyclin-Dependent Kinase 19 (CDK19 Human)
UseLentiviralTagsFlagExpressionMammalianPromoterEF1αAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC1A5_STOP
Plasmid#161140PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC1A5 (SLC1A5 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
t1-435
Plasmid#166578PurposeFor expression of human talin head (residues 1-435) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1 Head (1-435) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-435 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-CDK19-W105M-IRES-ZsGreen
Plasmid#68859PurposeExpresses Human CDK19 W105M MutantDepositorInsertCyclin-Dependent Kinase 19 (CDK19 Human)
UseLentiviralTagsFlagExpressionMammalianMutationW105MPromoterEF1αAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
ABL1 gRNA (BRDN0001147582)
Plasmid#77732Purpose3rd generation lentiviral gRNA plasmid targeting human ABL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
t1-405
Plasmid#166127PurposeFor expression of human talin-1 head (residues 1-405) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1Head (1-405) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
CHUK gRNA (BRDN0001149372)
Plasmid#77033Purpose3rd generation lentiviral gRNA plasmid targeting human CHUKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgACSL3.C-Cas9-P2A-Puro
Plasmid#129412PurposeEncoding Cas9 and sgACSL3.C for CRISPR/Cas9 mediated HDR tagging of endogenous human ACSL3 C-terminusDepositorInsertSpCas9 and sgACSL3.C (ACSL3 Human)
UseCRISPRTagsP2A-PuroExpressionMammalianPromoterhU6Available SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
AKT3 gRNA (BRDN0001144935)
Plasmid#76218Purpose3rd generation lentiviral gRNA plasmid targeting human AKT3DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_wt
Plasmid#156182PurposeDox-inducible expression of sgRNA-resistant SLC38A2 wild-type cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD90.2-Rluc_miR
Plasmid#163332PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the murine PGK promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-Rluc_miR
Plasmid#163333PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the LTR promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only