We narrowed to 15,984 results for: grna
-
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human DGCR8-2
Plasmid#14770DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human Drosha2
Plasmid#14767DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSuper mouse Drosha1
Plasmid#14780DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSuper mouse DGCR8-1
Plasmid#14772DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC155-pCR8-sgExpression
Plasmid#49045PurposeU6-driven sgRNA expressing cassette on a gateway donor vectorDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hU6-mU6-BlasGO
Plasmid#136906PurposeLentivirus for base editing activatable Blasticidin resistance gene expression in mammalian cells. All in one vector with sgBlasGO.DepositorInsertBlasCyGO
UseLentiviralMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_bKO
Plasmid#172225PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the centromeric human SOX17 CTCF-boundary.DepositorInsertsgRNA
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSAG1::CAS9-U6::sg290860-6
Plasmid#59855PurposeEncodes CAS9 nuclease (GFP fusion) under control of the Toxoplasma gondii SAG1 promotor. Vector also provides U6 controlled expression of a single guide RNA for CRISPR disruption of TGME49_290860.DepositorInsertCRISPR sg290860-6
UseCRISPR; ; toxoplasma gondiiAvailable SinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSuper mouse Dicer3
Plasmid#14778DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
Geph CR shRNA
Plasmid#121068PurposeshRNA targeting the coding region of the gephyrin mRNADepositorInsertGPHN shRNA (Gphn Rat)
UseRNAiAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRDA_186
Plasmid#133458PurposeU6 promoter expresses customizable Spyo-guide; PGK promoter expresses blasticidin resistance and 2A site provides EGFPDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.dTomato
Plasmid#89392PurposeLentiviral CRISPR-Cas9 delivery for sgRNA (hU6), dTomato coexpression, EFS Promoter drivenDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSR-puro-Mff1 shRNA
Plasmid#37247DepositorAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-mCh-Oct4i
Plasmid#21906DepositorInsertOct4i
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 30, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMBA323
Plasmid#214751PurposeTo create delta(glmS,nadE) working strains and maintaining their viabilityDepositorInsertBBa_J23105-cas9 + pBAD-λ Red genes + ptet-gRNA (pBR322ori)
UseCRISPRExpressionBacterialAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-RNF40i1
Plasmid#59594PurposeExpression of shRNA against human RNF40DepositorAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Tyr
Plasmid#170293PurposeA knock-out vector for the mouse tyrosinase.DepositorInsertA gRNA targeting the mouse tyrosinase gene.
UseCRISPR and LentiviralAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pV1435
Plasmid#111439PurposeSolo vector pV1382 + sgCgADE2DepositorInsertCaCas9/sgCgADE2
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only