We narrowed to 19,314 results for: Tat
-
Plasmid#96860Purposeguanine-agRNA (GFP activation, 18 nt blocker with bulges)DepositorInsertguanine-agRNA (GFP activation, 18 nt blocker with bulges)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT029h
Plasmid#96861Purpose(d)guanine-agRNA (GFP activation,18 nt blocker with bulges)DepositorInsert(d)guanine-agRNA (GFP activation,18 nt blocker with bulges)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049d
Plasmid#96862Purposeguanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsertguanine-agRNA (19 nt blocker with bulges, RFP activation)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049e
Plasmid#96863Purpose(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsert(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pM2_PLLaco1R1CI*_PLTetO1R1CI*
Plasmid#250895PurposeCassette 1: Mutated cI protein expressed under PL TetO1 promoter; Cassette 2: Mutated cI protein expressed under PL LacO1 promoter; part of BNeu AS10; colE1 origin of replicationDepositorInsertsMutated cI
Mutated cI
UseSynthetic BiologyMutationcI* = Frame shifted cI proteinPromoterPL LacO1 and PL TetO1Available SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pT2/sh-FYN1-GFP_Seq_C
Plasmid#201399PurposeKnockdown of FYN tyrosine kinase. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertFYN
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
E6SCX5
Plasmid#163275PurposeInducible expression of UniProt identifier E6SCX5DepositorInsertE6SCX5
Tags10xHis and T7ExpressionBacterialPromoterT7Available SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
J23100_PheS*_codon
Plasmid#247070Purposeexpress codon optimized PheS* gene with constitutive promoter BBa_J23100DepositorInsertmutated (A294G) E.coli PheS of which codon is changed
ExpressionBacterialAvailable SinceMarch 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
PromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-RiSxph
Plasmid#193102PurposeProtein expression in insect cellsDepositorInsertRanitomeya imitator saxiphilin
Tags3C-eGFP-His10ExpressionInsectPromoterpolyhedrinAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_As
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_As
Plasmid#155055PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_Lb
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY76
Plasmid#130963PurposeEngineered sgRNA-LEA2 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA2
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF1A06
Plasmid#70810PurposeGateway entry cloneDepositorInsertzetaTry (zetaTry Fly)
UseGateway CloningAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLY86
Plasmid#130949PurposeEngineered sgRNA-LEA2-WTmis2 generator circuit including promoter Plux2, 2 BoxB aptamers and 2 mis-matches in sgRNA scaffoldDepositorInsertsgRNA-LEA2-WTmis2
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
F0TBY7
Plasmid#163245PurposeInducible expression of UniProt identifier F0TBY7DepositorInsertF0TBY7
Tags10xHis and T7ExpressionBacterialPromoterT7Available SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only