We narrowed to 28,485 results for: Tat
-
Plasmid#124256PurposeLentiviral vector (pRRL) containing Her2-ITD specific T cell receptorDepositorAvailable SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pGEX6P1‐hsRNASEH2BCA(D34A/D169A)
Plasmid#108693PurposeFor expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A (with D34A and D169A catalytic site mutations) for purification of the RNase H2 trimeric enzymeDepositorTagsGSTExpressionBacterialMutationShine Dalgarno sequence upstream of start codon, …PromotertacAvailable SinceApril 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{DTR-GFP}on-WPRE
Plasmid#111395PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL delta IC
Plasmid#202422PurposeExpression of GFP-tagged PODXL without intracellular domainDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS6-ZF(VEGFA)-StaPL(AI)-YFP-VPR
Plasmid#111502PurposeExpresses a zinc finger specific to the human VEGFA locus, which is linked to a VPR transcriptional activation domain via a StaPL(AI) module, in mammalian cells. [AI = asunaprevir inhibited].DepositorInsertZF(VEGFA)-StaPL(AI)-YFP-VPR
ExpressionMammalianMutationThe HCV NS3 protease carries V36M, T54A, and S122…PromoterCMVAvailable SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS300E/S302D
Plasmid#62531PurposeSerine 300 of Drosha is mutated to glutamic acid and serine 302 is mutated to aspartic acidDepositorInserthuman Drosha with serine 300 changed to glutamic acid and serine 302 changed to aspartic acid (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged serine 300 to glutamic acid and serine 3…Available SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PYGL_WT_V5
Plasmid#82991PurposeGateway Donor vector containing PYGL, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.1
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-mCherry-STIM1
Plasmid#114176PurposeGateway entry clone containing mCherry-STIM1DepositorAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
cacnb4 (rat) in pMT2 vector
Plasmid#107426PurposeExpresses Calcium channel beta4 auxillary subunit in mammalian cellsDepositorAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
tetO-NR2F1
Plasmid#170698Purposedoxycycline-inducible overexpression of NR2F1DepositorInsertnuclear receptor subfamily 2 group F member 1 (NR2F1 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianMutationdeletion of 36G- please see depositor commentsPromoterTRE promoter, Tet-ONAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CRY2-INPP5E
Plasmid#79561Purposeexpression of mCherry-tagged CRY2PHR fused to inositol 5-phosphatase domain of human INPP5E with mutated C-terminal CaaX-motifDepositorInsertINPP5E (INPP5E Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationC-terminal region, aa 214_644, C641A mutation to …PromoterCMVAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
hKCNQ5(WT).ires.mScarlet-pcDNA3
Plasmid#204361PurposeHeterologous expression in mammalian cell lines or Xenopus oocyte (T7 RNA pol)DepositorAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CB1-HIF2a-GFP-T2A-Puro
Plasmid#71708PurposeLentiviral expression of HIF2A-GFPDepositorAvailable SinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(milli)-BoNT/B(147-441, Y365A)
Plasmid#122985PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(milli)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(milli)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains A58V,R73Q "milli" mutatio…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs-E55A-ATPIF1
Plasmid#85404PurposeRetroviral vector expressing human ATPIF1 with E55A mutation, which abrogates the interaction between ATPIF1 and the ATP synthaseDepositorInsertATPIF1 (ATP5IF1 Human)
UseRetroviralExpressionMammalianMutationE55A point mutation abrogating the ability of ATP…Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
hBACE1(D289N).ires.mCherry-pcDNA3
Plasmid#204363PurposeHeterologous expression in mammalian cell lines or Xenopus oocyte (T7 RNA pol)DepositorAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGFP-mHP1gamma
Plasmid#181902PurposeFluorescently tagged HP1gammaDepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5)
Plasmid#55799PurposeThis G protein alpha-s mutant exhibits increased affinity for and decreased ability to be activated by Gs-protein-coupled receptors as well as decreased ability to activate adenylyl cyclase.DepositorInsertG protein alpha-s with alpha-i2 substitutions in alpha3/beta5 loop (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T in alpha-s sequ…PromoterCMVAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only