We narrowed to 27,272 results for: STI
-
Plasmid#11983PurposeReporter gene with mouse c-fos promoter. Induced by serum and many growth factors in quiescent cells.DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-hSyn-PinkyCaMP
Plasmid#232856PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under hSyn promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterhSynAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSA091 PSMD14_IVS2-Cas9-BFP
Plasmid#249141PurposeOverexpression of SpCas9-BFP with PSMD14 IVS2 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPSMD14_IVS2-Cas9-TagBFP (PSMD14 Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationPSMD14 IVS2 intronPromoterEF1aAvailable SinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDYT001
Plasmid#186549PurposeLineage tracing vector (with barcoded Target Sites and triple sgRNAs)DepositorInsert14-bp random integration barcode and three target sites and 3x sgRNAs
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterEF1alphaAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDYT002
Plasmid#186550PurposeLineage tracing vector (with barcoded Target Sites and triple sgRNAsDepositorInsert14-bp random integration barcode and three target sites
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterEF1alphaAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-PinkyCaMP
Plasmid#232860PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CAG promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterCAGAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiTet-LDLR-mCherry BlastR
Plasmid#186739PurposeDox inducible LDLR coding sequence expression construct cloned into a lentiviral backbone containing a blasticidin resistance geneDepositorAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-human U6-sgRNA-EF1Alpha-puro-T2A-BFP
Plasmid#118594PurposeParental vector for the CRISPRa libraries. Expresses an sgRNA from the human U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertsgRNA/Puro-T2A-BFP
UseLentiviralExpressionMammalianPromoterEF1AlphaAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABEMAX-NLS-P2A_BLAST
Plasmid#135355PurposeExpression of ABEMax (wildtype Tada monomer coupled with evolved Tada monomer) with dual C-terminal NLS in a single operon encoding P2A blasticidine resistanceDepositorInsertABEMax-2XNLS
UseCRISPRExpressionMammalianMutationWTAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn FLEx-loxp Kir2.1-2A-GFP
Plasmid#161574PurposeExpression of Kir2.1-2A-GFP in a Cre-dependent fashionDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-mNeonGreen-BRD4
Plasmid#204692PurposeThis plasmid allows for inducible expression of short BRD4 isoform tagged with mNeonGreen, in mammalian cells.DepositorAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCV-opEBNA2-IRES-mCherry
Plasmid#220355PurposeExpresses EBV latent gene EBNA2 in mammalian cells (EBNA2 coding sequence was optimised for expression)DepositorInsertopEBNA2 (EBNA-2 Epstein-Barr Virus (EBV) strain B95-8)
UseRetroviralExpressionMammalianMutationcodon-optimised for expression in mammalian cellsAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-PinkyCaMP
Plasmid#232858PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CaMKII promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOD2044-intDEG
Plasmid#89366PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pelt-2 (intestine specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Nematode, Synthetic)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPelt-2Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
LV-pCMV-FLPo-pGK-mCl-GP33/66
Plasmid#216481PurposeExpresses FLPo and mClover3 fluorescent protein with LMCV GP33-43 and GP66-77 epitopes embedded in loop of mclover to initiate immunogenic tumor cells in KPFrt miceDepositorInsertsFLPo Recombinase
mClover3-GP33/66
UseLentiviralPromoterpCMV and pGKAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_VIP1.0
Plasmid#208682PurposeExpresses the genetically-encoded fluorescent vasoactive intestinal peptide (VIP) sensor GRAB_VIP1.0 in mammalian cellsDepositorInsertGPCR activation based vasoactive intestinal peptide (VIP) sensor GRAB_VIP1.0
ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDF-His-mTET1CD
Plasmid#81053Purposebacterial expression of the catalytic domain of murine TET1DepositorInsertTET1 (Tet1 Mouse)
Tags6HISExpressionBacterialMutationcatalytic domain amino acid 1367-2057PromoterT7Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
hRAP-pEZT-BM
Plasmid#177986PurposeExpression human RAP containing a C-terminal 6xHis tag in mammalian cellsDepositorInsertLDL receptor related protein associated protein 1 (LRPAP1 Human)
Tags6xHisExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
JG1211: CAG-human dLbCpf1(D832A)-NLS-3xHA-VPR
Plasmid#104567PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to VPR activatorDepositorInserthuman codon optimized ‘dead’ Cpf1 fused to HSV VPR activation domain
UseCRISPRTagsNLS-3xHA-VPRExpressionMammalianMutationD832APromoterCAGAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only