We narrowed to 14,061 results for: CAN
-
Plasmid#213588PurposeDoxycycline inducible expression of TAZ-S89A cDNA in mammalian cellsDepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only
-
p2R3a-VenusYFP-3AT
Plasmid#71269PurposeEntry clone containing Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertVenusYFP
UseGatewayTags4xGly linker and T3A pea Pisum sativum ribulose-1…Available SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER12 (miR-RUL)
Plasmid#46935PurposeInducible lentiviral gene silencing vector. Insert PheSGly294, (XhoI to EcoRI;1.4kb),can be replaced w mir30 based hairpin of interestDepositorInsertPheS Gly294
UseLentiviralAvailable SinceNov. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFP-GIGYF1
Plasmid#141188PurposeExpresses GFP-GIGYF1 in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pInducer-TAZ-S89A/S311A
Plasmid#213589PurposeDoxycycline inducible expression of TAZ-S89A/S311A cDNA in mammalian cellsDepositorAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
1073A(HomeR1)=pBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
Plasmid#159676PurposePlasmid provides the HomeR#1 gene drive element harboring a rescue, gRNA#1, and 3xP3-eGFP that can be integrated via pBac and inserted at Pol-γ35 site #1 via HDR.DepositorInsertpBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
ExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 deltaCRIM
Plasmid#124921PurposeFor expression of Conserved Region In Middle deletion mutant of SIN1-GFP (delta139-267)DepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 deltaPH
Plasmid#124922PurposeFor expression of Pleckstrin Homology domain deletion mutant of SIN1-GFP (delta376-486)DepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-3xVenusYFP-OcsT
Plasmid#71271PurposeEntry clone containing three repeats of Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsert3 times VenusYFP
UseGatewayTagsoctaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only