165,971 results
-
Plasmid#56018PurposeLocalization: Mitochondria, Excitation: 440, Emission: 620DepositorAvailable SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1 - TRC cloning vector
Plasmid#10878Purpose3rd generation transfer plasmidDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral and RNAiExpressionMammalianAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV CEPIA2mt
Plasmid#58218PurposeGreen fluorescent indicator for calcium imaging in the mitochondriaDepositorInsertCEPIA2mt
TagsmycExpressionMammalianMutationGCaMP2 N263Y E282V M339LPromoterCMVAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-mTagBFP2
Plasmid#99374PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-TFEB
Plasmid#38119PurposeMammalian expression of Transcription factor EB fused to EGFPDepositorAvailable SinceJuly 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLTR-RD114A
Plasmid#17576DepositorInsertRD114 envelope glycoprotein
UseLentiviralExpressionMammalianAvailable SinceApril 14, 2008AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-FLEX-SaCas9-U6-sgRNA
Plasmid#124844PurposeVector for Cre-dependent expression of SaCas9DepositorInsertSaCas9, gRNA scaffold
UseAAV, CRISPR, and Mouse TargetingTagsNLS and NLS-3xHAAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_IRES_GFP_CD16a
Plasmid#196189PurposeRetroviral expression plasmid for generating stable FCGR3A (CD16a)-expressing cell lines.DepositorInsertCD16a (FCGR3A Human)
UseRetroviralExpressionMammalianMutationchanged Phenylalanine 158 to ValinePromoterLTRAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
8xGTIIC-luciferase
Plasmid#34615PurposeYAP/TAZ-responsive synthetic promoter driving luciferase expressionDepositorInsertsynthetic TEAD luciferase reporter
UseLuciferaseAvailable SinceMarch 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-eGFP
Plasmid#99375PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A eGFP from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-eGFP
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP
Plasmid#37825PurposeAAV-mediated expression of GFP under the CAG promoterDepositorHas ServiceAAV CAP-B10, AAV CAP-B22, AAV MaCPNS1, AAV MaCPNS2, AAV PHP.eB, AAV Retrograde, AAV Retrograde trial size, AAV1, AAV1 trial size, AAV11, AAV11 trial size, AAV2, AAV2 trial size, AAV5, AAV5 trial size, AAV6, AAV6 trial size, AAV8, AAV8 trial size, AAV9, AAV9 trial size, and AAV9-X1.1InsertGFP
UseAAV; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
dCas9-VPR_P2A_mCherry
Plasmid#154193PurposeLentiviral expression plasmid encoding dCas9-VPR and a P2A linked mCherry markerDepositorInsertsp-dCas9-VPR_P2A_mCherry
UseLentiviralExpressionMammalianMutationD10A, H840APromoterEF1asAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-3FLAG-EEA1
Plasmid#176491PurposeFor lentiviral transduction of 3FLAG-EEA1DepositorAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNP3425 [pNP2922 - ISCro4 Enhanced bRNA (TBL4, WT + DBL3, WT) + ISCro4 Recombinase (WT)]
Plasmid#247262PurposeExpress ISCro4 recombinase and bridge RNADepositorInsertpNP2922 - ISCro4 bRNA1-179 C60U, A61G, U73C, dU86, A87G, dU88, ins179(rc(101-111) (TBL4+DBL3)
ExpressionMammalianMutationC60U, A61G, U73C, dU86, A87G, dU88, ins179(rc(101…Available SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSETB/mStayGold
Plasmid#212017PurposemStayGold has an n1 adaptor at its N-terminus and is useful for C-terminal tagging. This construct is used also for expression of mStayGold itself.DepositorInsertmStayGold
ExpressionBacterialPromoterT7Available SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dR8.2 dvpr
Plasmid#8455Purpose2nd* generation lentiviral packaging plasmid. (*See comments section.) Can be used with 2nd and 3rd generation transfer vectors. Use in conjunction with an envelope plasmid such as pCMV-VSV-G.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLX_311-KRAB-dCas9
Plasmid#96918Purposefor CRISPRi, lentiviral expression of KRAB-dCas9 and BlastR. Also called pXPR_121DepositorInsertdCas9
UseLentiviralTagsKRABExpressionMammalianMutationdCas9PromoterEF1aAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-mCherry-Nanobody
Plasmid#70696PurposeExpresses GST-tagged anti-mCherry Nanobody in E. coli cells.DepositorInsertmCherry-Nanobody
TagsGSTExpressionBacterialAvailable SinceMarch 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-HaloTag7-LC3
Plasmid#184899PurposeStable expression of HaloTag7-LC3 in mammalian cells to measure autophagic fluxDepositorInsertLC3B
TagsHaloTag7ExpressionMammalianAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only