We narrowed to 14,348 results for: cas9
-
-
pFA0057
Plasmid#131784PurposeGuide RNA (gGFP) and Cas9 expression plasmid for cleaving pFA6 series GFP C-terminal tagging cassettes, including GFP-His3MX6. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer GFP cassette guide (gGFP) and 5' sgRNA
ExpressionBacterial and YeastAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
LentiCRISPR-sgC17orf89-2
Plasmid#86135PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorInsertsgRNA targeting C17orf89 (NDUFAF8 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-3
Plasmid#86136PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-1
Plasmid#86137PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCm7RNA6A
Plasmid#84367PurposeCas9-gRNA plasmid for mouse Cbfa2t2 m7 mutant knockinDepositorInsertCbfa2t2 m7-gRNA6
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCBFKOgRNA5
Plasmid#84366PurposeCas9-gRNA plasmid for mouse Cbfa2t2 KnockoutDepositorInsertCbfa2t2-gRNA5
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCBFKOgRNA2
Plasmid#84365PurposeCas9-gRNA plasmid for mouse Cbfa2t2 KnockoutDepositorInsertCbfa2t2-gRNA2
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
TU#1805_CRISPR_unc-73_exon2
Plasmid#82359Purposeto create unc-73B null alleleDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-GG-acceptor
Plasmid#132777PurposePrime editing in mammalian cellsDepositorInsertExchangeable cassette
ExpressionMammalianMutationSee manuscriptPromoterU6Available SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTOPO-col10a1-KI-donor
Plasmid#184874PurposeDonor template for knock-in of p2a-CreERT2 into the medaka col10a1 locus via CRISPR/Cas9-mediated homology directed repairDepositorInsertsCollagen10a1 5' homology arm
Collagen10a1 3' homology arm
p2a-CreERT2
Myosin light chain 2 promoter
eGFP
UseCRISPR and Cre/LoxAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pG3H-PE3max-attR1R2
Plasmid#213049PurposeDestination vector Expressing nCas9 and RT fusion protein and carrying Gateway recombination sitesDepositorInsertsCas9 nickase
M-MLV Reverse Transcriptase
UseNote: this plasmid needs helper pvs1-vir2 for rep…ExpressionPlantMutationH840A, R240K, N413K,Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_052
Plasmid#136474PurposeLentiviral expression of AsCas12a gRNADepositorInsertPuromycin resistance
UseLentiviral and Synthetic BiologyPromoterEF1aAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-scramble
Plasmid#206924PurposePlasmid expressing Cas9, GFP and non-targeting guides for using as a control in CRISPR experimentsDepositorInsertnon-targeting human sgRNA guides
UseCRISPRPromoterU6Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJ204-loxP-EF1a-mCherry-NeoR-lox2272-BGHpA-siteA-HDR
Plasmid#154826PurposeLanding pad for Cre/lox-based recombinase-mediated cassette exchange (RMCE) in CHO cells, donor plasmid for CRISPR/Cas9-mediated targeted integration in CHO cells (site A)DepositorInsertsmCherry
NeoR
ZsGreen1-DR
UseCRISPR and Cre/LoxTagsPESTExpressionMammalianPromoterCMV, EF1a, and SV40 early promoterAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only
