We narrowed to 28,960 results for: tat
-
Plasmid#111397PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON hM4Di-mCherry (Gi-coupled DREADD for neuronal silencing), W3SL cassette (for maximize cloning capacity)DepositorInsertsUseAAVTagsMyc and mCherryExpressionMammalianPromoterhSynapsinAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pCW57-Cx26-IRES-GCaMP6s
Plasmid#188236Purpose3rd generation, inducible bicistronic lentiviral plasmid for expression of human connexin 26 and GCaMP6sDepositorInsertGJB2 (GJB2 Human)
UseLentiviralTagsGCaMP6sExpressionMammalianPromoterTight TRE promoterAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2/V5-DEST CDC42EP1 S192A
Plasmid#69820PurposeExpresses CDC42EP1-V5 in mammalian cellsDepositorInsertCDC42 effector protein (CDC42EP1 Human)
TagsV5ExpressionMammalianMutationS192APromoterCMVAvailable SinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_S100A13_WT_V5
Plasmid#82975PurposeGateway Donor vector containing S100A13, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐hsRNASEH2BCA(D34A/D169A)
Plasmid#108693PurposeFor expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A (with D34A and D169A catalytic site mutations) for purification of the RNase H2 trimeric enzymeDepositorTagsGSTExpressionBacterialMutationShine Dalgarno sequence upstream of start codon, …PromotertacAvailable SinceApril 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{DTR-GFP}on-WPRE
Plasmid#111395PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-puro/RAF1-S259A
Plasmid#131727PurposeMammalian Expression of RAF1DepositorAvailable SinceMay 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW-ND-Cdt1ΔR198A/R210A-HA-Puro
Plasmid#193769PurposeDoxycyline-inducible (TetOn) human Cdt1 (SV40 NLS , C-terminal HA ) w/ mutations stopping S phase degradation and in MCM binding (R198A/R210A), expressed from all-in-one pCW vector (TetOn + rtTA)DepositorInsertND-Cdt1ΔR198A/R210A (CDT1 Human)
UseLentiviralTagsHAMutationamino acids 1-19 deleted, ΔCy mutation (aa68-70 t…PromoterTREAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS6-ZF(VEGFA)-StaPL(AI)-YFP-VPR
Plasmid#111502PurposeExpresses a zinc finger specific to the human VEGFA locus, which is linked to a VPR transcriptional activation domain via a StaPL(AI) module, in mammalian cells. [AI = asunaprevir inhibited].DepositorInsertZF(VEGFA)-StaPL(AI)-YFP-VPR
ExpressionMammalianMutationThe HCV NS3 protease carries V36M, T54A, and S122…PromoterCMVAvailable SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
FRIG-myc-Sema4D-CD4
Plasmid#51606Purposeexpresses myc-tagged Sema4D/CD4 non-cleavable chimera with extracellular Sema4D, intracellular CD4 in lentiviral backboneDepositorInsertSema4D/CD4-FLAG (Sema4d Mouse, Human)
UseLentiviralTagsFLAG and mycExpressionMammalianMutationSema4D amino acids 660-861 were replaced with CD4…PromoterRSVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-mCherry-STIM1
Plasmid#114176PurposeGateway entry clone containing mCherry-STIM1DepositorAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJV137
Plasmid#124256PurposeLentiviral vector (pRRL) containing Her2-ITD specific T cell receptorDepositorAvailable SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
cacnb4 (rat) in pMT2 vector
Plasmid#107426PurposeExpresses Calcium channel beta4 auxillary subunit in mammalian cellsDepositorAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PYGL_WT_V5
Plasmid#82991PurposeGateway Donor vector containing PYGL, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.1
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS300E/S302D
Plasmid#62531PurposeSerine 300 of Drosha is mutated to glutamic acid and serine 302 is mutated to aspartic acidDepositorInserthuman Drosha with serine 300 changed to glutamic acid and serine 302 changed to aspartic acid (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged serine 300 to glutamic acid and serine 3…Available SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pB-3xFlag-dCas13-mTET2HxDCD
Plasmid#228235PurposeFor targeted tethering of an inactive mutant (HxD) of the catalytic domain of mouse TET2 using dCas13DepositorInsertsUseCRISPRExpressionMammalianMutationCD (cysteine-rich, dioxygenase domain) truncation…PromoterCAGAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CRY2-INPP5E
Plasmid#79561Purposeexpression of mCherry-tagged CRY2PHR fused to inositol 5-phosphatase domain of human INPP5E with mutated C-terminal CaaX-motifDepositorInsertINPP5E (INPP5E Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationC-terminal region, aa 214_644, C641A mutation to …PromoterCMVAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CB1-HIF2a-GFP-T2A-Puro
Plasmid#71708PurposeLentiviral expression of HIF2A-GFPDepositorAvailable SinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only