We narrowed to 41,828 results for: LAT
-
Plasmid#205534PurposeExpress mCherry-MS2x2 (export tag consisting of 2 tandem repeats of MS2 stem-loop aptamer)DepositorInsertmCherry
ExpressionMammalianMutationWTPromoterCMVAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
FRP791_insul-(lexA-box)1-PminCYC1-Citrine-TCYC1
Plasmid#58432PurposeInduces Citrine expression from a promoter containing 1 lexA box in yeast cellsDepositorInsertCitrineA206K
ExpressionYeastPromoterinsul-(lexA-box)1-PminCYC1Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
Coronin1B-pmCherryN1
Plasmid#27694DepositorAvailable SinceMay 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-07
Plasmid#124786PurposeTemplate for C-terminal PCR tagging of mammalian genes (without selection) with mNeonGreenDepositorInsertmNeonGreen
UsePcr templateTagsmNeonGreenPromoterNoneAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
mpeg:lamp2-mCherry-stop; cmlc2:GFP
Plasmid#213740PurposeExpresses Lamp2-mCherry in the macrophage lineage of zebrafish with a green heart transgenesis markerDepositorInsertlamp2-mCherry
UseZebrafishPromotermpeg1.1Available SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
human p53-(1-360)
Plasmid#24865DepositorAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
MRAS
Plasmid#55661Purposeexpression of mouse MRASDepositorAvailable SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rif
Plasmid#23233DepositorAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDD121
Plasmid#91833PurposeCas9 expression in C. elegansDepositorInsertCas9
UseCRISPRExpressionWormMutationCodon optimized and with synthetic introns for C.…Available SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
lvl0-G-Gal4-VPR
Plasmid#229187Purposelvl 0 5 geneDepositorInsertGal4-VPR
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5B-Flag-Par6 wt
Plasmid#11748DepositorAvailable SinceAug. 4, 2006AvailabilityIndustry, Academic Institutions, and Nonprofits -
YEp181-CUP1-His-Smt3
Plasmid#99536PurposeYeast episomal vector for expression of His-tagged Smt3 (SUMO); LEU2 markerDepositorAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-rSyntaxin-3a
Plasmid#195206PurposeMammalian expression vector for GFP tagged Syntaxin-3a.DepositorInsertSTX3A (Stx3 Rat)
ExpressionMammalianAvailable SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJAT62
Plasmid#204301PurposeExpress phiC31 under control of D. melanoagaster vasa promoter, with Vasa 3’UTR.DepositorInsertie1-EGFP
UseCRISPRPromoterie1Available SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
H6-auxilin
Plasmid#62571Purpose6xHis-tagged full-length bovine brain auxilin (auxilin 1) in pQE30 for protein expression in bacteriaDepositorInsertAuxilin
Tags6XHisExpressionBacterialMutation*see comment belowAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
[pSK581] pRK5 HA-SLC38A9N
Plasmid#136141Purposemammalian expression of SLC38A9 N term fragment (1-119)DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAd5-B6/7deltaE3
Plasmid#175748PurposeA block for the AdenoBuilder genome assembly system. The insert consolidates the regions present in pAd5-B6deltaE3 and pAd5-B7.DepositorInsertAdenovirus 5 genomic region 25043-35938
UseAdenoviral and Synthetic BiologyMutationAdenovirus sequences 27859-30803 replaced with Ba…Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHA-PUMA DeltaBH3
Plasmid#16589DepositorAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
hSDH5
Plasmid#113046PurposeExpression of WT hSDH5DepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only