We narrowed to 25,346 results for: Spr
-
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV SpCas9
Plasmid#206268PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes SpCas9 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertSpCas9
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLY152
Plasmid#130950Purposedcas9 generator and reporter circuit (PpspA-2G6 with sfgfp::ASV)DepositorInsertsdcas9
tetR
sfgfp
UseSynthetic BiologyTagsASV tagExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterPpspA-2G6 and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgMAPKAP1_1
Plasmid#124912PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.Ollas.S_mCherry-NLS
Plasmid#178279PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.Ollas.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.S.V5_mCherry-NLS
Plasmid#178278PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.S.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.V5_mCherry-NLS
Plasmid#178277PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.Ollas.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.S_mCherry-NLS
Plasmid#178273PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-PE VQR
Plasmid#162797PurposeAll-in-one prime editor piggyBac transposon, VQR variantDepositorInsertSpCas9_H840A_VQR-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationD1135V, R1335Q, T1337RPromoterCAGAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc enAspCas12a
Plasmid#182127PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc enAspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc enAspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB-hCRY1-SNAP-CD4-bla
Plasmid#179447PurposeDonor vector to knock in SNAPtag C-terminal to human CRY1 geneDepositorInsertSnapTag
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.S.VSVg_mCherry-NLS
Plasmid#178269PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.S.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.VSVg_mCherry-NLS
Plasmid#178261PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.S_mCherry-NLS
Plasmid#178260PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.S.VSVg_mCherry-NLS
Plasmid#178255PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.S.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only