We narrowed to 3,314 results for: GCT
-
Plasmid#89796PurposeExpresses shRNA against TOM40.DepositorInsertshRNA Tom40
UseTagsnoneExpressionMammalianMutationPromoterU6Available sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRTagsExpressionMutationPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(B)
Plasmid#236041PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRTagsExpressionMutationPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRTagsExpressionMutationPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NRF2
Plasmid#214692PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human NRF2DepositorInsertdgRNA_NRF2 (NFE2L2 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHW00015
Plasmid#222446PurposeLevel 0, C terminal tag module (TTCG-GCTT) containig VP64-NLS.DepositorInsertVP64-NLS
UseSynthetic BiologyTagsExpressionPlantMutationnoPromoterAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHW00014
Plasmid#222445PurposeLevel 0, C terminal tag module (TTCG-GCTT) containing VP16-NLS.DepositorInsertVP16-NLS
UseSynthetic BiologyTagsExpressionPlantMutationnoPromoterAvailable sinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
msHook2 g1 lentiCRISPRv2-mCherry
Plasmid#218652PurposeKnockout vector for mouse Hook2DepositorInsertHook2 (Hook2 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
msHook2 g2 lentiCRISPRv2-mCherry
Plasmid#218653PurposeKnockout vector for mouse Hook2DepositorInsertHook2 (Hook2 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-gR085
Plasmid#188554PurposeBinary vector for CRISPR/Cas9 targeted to MpIGPD in Marchantia polymorpha (for Agrobacterium-mediated genetic transformation)DepositorInsertgR085
UseCRISPR; Entry vectorTagsExpressionMutationPromoterAvailable sinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-gR085
Plasmid#188552PurposeGateway entry vector for sgRNA targeted to MpIGPD.Transient expression of sgRNA targeted to MpIGPD in Marchantia polymorpha.DepositorInsertgR085
UseCRISPR; Entry vectorTagsExpressionMutationPromoterAvailable sinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CB0026
Plasmid#162285PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-AATG. Generates plasmids for SP6-driven TNT SP6 Coupled Wheat Germ Extract SystemDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CB0246
Plasmid#162286PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-CCAT. Generates plasmids for SP6-driven TNT SP6 Coupled Wheat Germ Extract SystemDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0027
Plasmid#162309PurposeLevel 0 C-terminal tag part for MoClo assembly, TTCG-GCTTDepositorInsertC-terminal tag, 9 aa linker, superfolder GFP, strep tag, stop codon
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0283
Plasmid#162288PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-CCAT. Generates plasmids for SP6-driven TNT SP6 Coupled Wheat Germ Extract SystemDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0282
Plasmid#162287PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-AATG. Generates plasmids for SP6-driven TNT SP6 Coupled Wheat Germ Extract SystemDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0244
Plasmid#162282PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-CCAT, adds a N-terminal expression tag. Generates plasmids for T7-driven E. coli cell-free protein synthesisDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0024
Plasmid#162281PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-AATG, adds a N-terminal expression tag. Generates plasmids for T7-driven E. coli cell-free protein synthesisDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgDcc
Plasmid#159906PurposeMutagenesis of DccDepositorInsertDcc (Dcc Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CAPsg
Plasmid#154344PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCAP sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only