We narrowed to 16,416 results for: grn
-
Plasmid#191105PurposeBackbone for lentiviral pegRNA library construction with hMLH1dn and Puro markerDepositorInserthMLH1dn
UseCRISPR and LentiviralExpressionMammalianMutationI31 silent mutation (ATA to ATC) to remove early …PromoterEF-1aAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFD4-U6:1_U6:3tandemgRNAs
Plasmid#49411Purposeexpression of two gRNAs from Drosophila U6:1 and U6:3DepositorInsertsdU6-1:gRNA
dU6-3:gRNA
UseCRISPRExpressionInsectPromoterdU6-1 and dU6-3Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
MAP2K4 gRNA (BRDN0001145410)
Plasmid#76651Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP2K4 gRNA (BRDN0001148854)
Plasmid#76652Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-scramble
Plasmid#206924PurposePlasmid expressing Cas9, GFP and non-targeting guides for using as a control in CRISPR experimentsDepositorInsertnon-targeting human sgRNA guides
UseCRISPRPromoterU6Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-sgRNA-RFP
Plasmid#166005PurposeBacterial expression of dCas9 (aTc control) and sgRNA (arabinose control)DepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
hNTa1-qgRNA-pYJA5
Plasmid#217779PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_empty-sgRNA(PP7)
Plasmid#232432Purposeempty gRNA backbone which contains the PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged sgRNA scaffold driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MP-84-spCas9-U6-gRNA
Plasmid#206935PurposeExpression of spCas9 endonuclease and gRNA in an AAV vector allowing packaging of viral genome smaller than 5 kb.DepositorInsertspCas9
UseAAVTagsSV40 NLSExpressionMammalianPromoterMP-84Available SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
MS2-epegRNA-Dnmt1
Plasmid#211372PurposeDnmt1 targeting epegRNA with MS2 insertion in gRNA scaffold for v3 PE-eVLP productionDepositorInsertMS2-epegRNA
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDAS12222_U6-pegRNA-BFP
Plasmid#177181PurposepegRNA cloning plasmid with BFP markerDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-dU6:3gRNA
Plasmid#49410Purposeexpression of gRNA under control of the Drosophila U6:3 promoterDepositorInsertdU6-3:gRNA
UseCRISPRExpressionInsectPromoterdU6-3Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001146750)
Plasmid#77280Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001146095)
Plasmid#77278Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_B
Plasmid#74375PurposegRNA_B to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA1-gRNA_A
Plasmid#74374PurposegRNA_A to knockout human AMPK alpha 1 using Cas9nDepositorAvailable SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFD3.1-w-dU6:3gRNA
Plasmid#123366PurposegRNA expression plasmid for CRISPR mutagenesis in Drosophila (with mini-white transformation marker).DepositorInsertU6:3-gRNA
UseCRISPRExpressionInsectAvailable SinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX-sgRNA-BfuAI-2k
Plasmid#112915PurposeEmpty sgRNA expression plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-LMNA-gRNA1
Plasmid#122507Purposeexpresses WT spCas9 and a chimeric gRNA targeting human LMNADepositorInsertLMNA-gRNA1
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only