We narrowed to 4,521 results for: GCA;
-
Plasmid#62255Purposeexpression of A1NT sgRNA from the arabinose-inducible promoterDepositorInsertA1NT
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
L1_lacZgRNA-Ck3
Plasmid#136136PurposeL1 in position 3, to clone gRNA target using BbsI, lacZ blue-white screeningDepositorInsertp5-MpU6:lacZgRNA
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJYS3_ΔcrtYf
Plasmid#85542PurposeConstitutive transcription of FnCpf1 and crRNA of crtYfDepositorInsertsCpf1
crRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
L1_lacZgRNA-Ck2
Plasmid#136137PurposeL1 in position 2, to clone gRNA target using BbsI, lacZ blue-white screeningDepositorInsertp5-MpU6:lacZgRNA
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBOBI-TRPV2-C-GC6s
Plasmid#249436PurposeUsed for transfection of cells for expression of TRPV2 and GCamp6sDepositorInsertTRPV2 and GCamp6s (TRPV2 Human)
ExpressionMammalianAvailable SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop A
Plasmid#171779PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-DogTag Loop A
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Val2…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mU6-GFPGO2-IRES-mScarletI
Plasmid#136896PurposeLentivirus for base editing activatable GFP expression in mammalian cells. All-in-one vector with sgGO.DepositorInsertGFPGO2-IRES-mScarletI
UseLentiviralTags2xNLS on GFP, 3xNLS on mScarletMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
D. vulgaris sp2 CRISPR/pACYCDuet-1
Plasmid#81186PurposeExpresses CRISPR array containing 3 copies of Desulfovibrio vulgaris spacer 2 and flanking repeats in E. coliDepositorInsertSynthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
UseCRISPRTagsNoneExpressionBacterialPromoterT7Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-PCNT
Plasmid#227284PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of PCNT for knock-in.DepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pyc126m
Plasmid#158777Purposeribosome-tagged GCaMP for soma localizationDepositorInsertGCaMP6m-RPL10a
UseAAVAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pyc111s
Plasmid#158781Purposeribosome-tagged, Cre-dependent GCaMP for soma localizationDepositorInsertGCaMP6s-RPL10a
UseAAVAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRIN-shMYB.2652
Plasmid#105575PurposeDox-inducible mir30 MYB shRNA/dsRED expression with Venus marker and neo resistanceDepositorInsertMYB shRNA #2652
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKL001
Plasmid#98917PurposeConstitutively expresses the CaPR construct, the voltage indicator PROPS tethered to the calcium sensor GCaMP6f, under the Sigma 70 promoter in E. coli.DepositorInsertCaPR
ExpressionBacterialPromoterBBa_J23118 - Strong ConstitutiveAvailable SinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBabe neo TGFBR3-HA
Plasmid#83095PurposeRetroviral vector for constitutive TGFBR3 expression with C-terminal HA tagDepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pyc111f
Plasmid#158780Purposeribosome-tagged, Cre-dependent GCaMP for soma localizationDepositorInsertGCaMP6f-RPL10a
UseAAVAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pyc111m
Plasmid#158779Purposeribosome-tagged, Cre-dependent GCaMP for soma localizationDepositorInsertGCaMP6m-RPL10a
UseAAVAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJAT71
Plasmid#204305PurposeExpresses jGCaMP7s-T2A-tdTomato under UAS control. HDR event marked with removable ie1XP3-DsRed cassette expressed in abdomen and mouthparts.DepositorInsertie1-DsRed
UseCRISPRPromoterie1Available SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBMN-AS-HNF4α
Plasmid#139305PurposeKnocking down of human HNF4α through shRNA and amiRNA targeting HNF4αDepositorInsertshRNA and amiRNA against HNF4α
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPU-huTRIMmiR30-TRIM5
Plasmid#132938PurposeAll-in-one huTRIM5 rescue-TRIM5 shRNA knockdownDepositorInserthuman TRIM5
UseLentiviral and RNAiExpressionMammalianPromoterSFFVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only