-
Plasmid#154770Purposeplasmid with 4xG1 PylT cassette (G1 PylT mutant A41AA C55A) and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
UseTagsExpressionMammalianMutation150TAG in GFP reporter, G1 PylT with A41AA and C5…PromoterEF1Available sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3_mTq2-Tat_YPet-PCP (cy-plasmid)
Plasmid#127636PurposeEncodes two fluorecent proteins with RNA binding peptides: mTurquoise2-Tat and YPet-PCP. Expression with constitutive E. coli RNAP promoter (J23106), ribozymes RiboJ10 (for YPet) and PlmJ (for mTq2)DepositorInsertmTurquoiuse2-Tat, YPet-PCP
UseSynthetic BiologyTagsRNA binding peptide: PCP and RNA binding peptide:…ExpressionBacterialMutationPromoterAvailable sinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
ABE8.13-d
Plasmid#136297Purposeexpresses ABE8.13-d in mammalian cellsDepositorInsertABE8.13-d
UseTagsC-terminal BPNLSExpressionMammalianMutationD10A in S. pyogenes Cas9, TadA mutations describe…PromoterAvailable sinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
1184_pAAV-U6-ApoB-gRNA2-CB-EmGFP
Plasmid#89062PurposeAAV-gRNA targeting the murine Apob geneDepositorInsertEmGFP
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterChicken beta actin with partial CMV enhancerAvailable sinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET22b Ag43 160N 6H sfGFP-R5 AmpR
Plasmid#225139PurposeRecombinant Ag43 protein fused to silaffin-R5 and sfGFP. pelB as the periplasmic signal. His-tag for purification. TEV enzyme recognition site between Ag43 alpha subunit and the fluorescent protein.DepositorInsertAg43 protein fused to silaffin-R5 and sfGFP
UseTagsHis tagExpressionBacterialMutationPromoterT7Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPSt_35Spr-GFP-t35S
Plasmid#203592PurposeFully assembled Plant STARR-seq plasmid with the 35S terminator.DepositorInsertsCaMV 35S promoter + Zm00001d041672 5'UTR
eGFP
CaMV 35S terminator
UseTagsExpressionPlantMutationPromoterAvailable sinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xKBstTyrT(CUA)_EF1_sfGFP 102TAG 150TAA
Plasmid#174895Purposeamber and ochre dual suppression reporter sfGFP 102TAG 150 TAA expression, with BstTyr(CUA) amber suppressor tRNA cassetteDepositorInsertsfGFP
UseTagsExpressionMammalianMutation102TAG 150TAA in sfGFPPromoterEF1Available sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-CI
Plasmid#196849PurposeExpression of green fluorescent reporter AcGFP driven by the strong Beta-actin promoterDepositorInsertAcGFP
UseTagsExpressionMammalianMutationNone (wt)PromoterChicken bactin (plus Chicken bactin intron)Available sinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENeCFPCNAL2 pc922
Plasmid#167563PurposeFor construction of CFP-tagged human PCNA, the GFP coding sequence in the pENeGFPCNAL2 vector was replaced by the ECFP coding sequence from the pECFP-C1 vector (Clontech Laboratories, Inc., CA).DepositorInsertsUseTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(103)-GFP
Plasmid#197890PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(553)-GFP
Plasmid#197888PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(285)-GFP
Plasmid#197889PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVTagsExpressionMutationN/APromoterCAGAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD128
Plasmid#163097PurposeExpression of mTurquoise2_H-NSdbd in Escherichia coli (and, potentially, other bacteria)DepositorInsertmTurquoise2_H-NSdbd
UseTagsExpressionBacterialMutationPromoteraraBAD promoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTone-gata2aECE-nsGFP
Plasmid#132975Purposegata2a endothelial enhancer (x6) and basal promoter driving nuclear-localized sfGFP in pTol1 backboneDepositorInsertsnuclear localized sfGFP
gata2a endothelial enhancer (x6) with a carp b-actin basal promoter
UseUnspecified; Transposon-mediatedTags6x myc and SV40 NLSExpressionMutationPromoterAvailable sinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
p2706-pHAGE-EF1aL-YAP5SA-UBC-GFP
Plasmid#216475Purposelentiviral dual expression of YAP5SA and eGFPDepositorInsertsYAP5SA
eGFP
UseLentiviralTagsExpressionMutationS61A, S109A, S127A, S164A, S381APromoterEF1aL and UBCAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1_VNp-LZ-VenusN154_VNp-LZ-VenusC155 (BiFC construct)
Plasmid#182395PurposeBacterial expression of Vesicle Nucleating peptide-Leucine Zipper-amino-half_mVenus BIFC fragment n and Vesicle Nucleating peptide-Leucine Zipper-carboxyl-half_mVenus BIFC fragment fusionsDepositorInsertsVNp-LZ-VenusN154
VNp-LZ-VenusC155
UseTagsVesicle Nucleating peptide (VNp) & Leucine Zi…ExpressionBacterialMutationPromoterT7Available sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mCerulean 156-239-GGGS
Plasmid#162616PurposeAllows for transcription of control mCerulean fluorophore half for injection into zebrafish embryos for BiFC assaysDepositorInsertmCerulean
UseTagsExpressionMammalianMutation156-239PromoterAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mVenus1-155-GGGS
Plasmid#162610PurposeAllows for transcription of control mVenus fluorophore half for injection into zebrafish embryos for BiFC assaysDepositorInsertmVenus
UseTagsExpressionMammalianMutationContains aa1-155 of mVenusPromoterAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H74
Plasmid#170338PurposemTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
UseTagsExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only