We narrowed to 16,448 results for: GRN
-
-
-
scramble shRNA
Plasmid#1864Purpose3rd gen lentiviral negative control vector containing scrambled shRNADepositorInsertscramble
UseLentiviral and RNAiExpressionMammalianAvailable SinceApril 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUPER TBK1
Plasmid#26210DepositorInsertpSUPER TBK1 (TBK1 Human)
UseRNAiAvailable SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-mTagBFP2-NLS-BsmBI_entry (pRW1506)
Plasmid#225754PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with nuclear-localized mTagBFP2-NLS; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR
Plasmid#42875PurposeA crRNA expression plasmid for targeting a specific sequence.DepositorInsertCRISPR-BsaI
UseCRISPR; E.coliExpressionBacterialAvailable SinceMarch 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-Opti
Plasmid#163126PurposeLentiCRISPRv2 variant with modified sgRNA scaffold from Chen et al. 2013 Cell.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR
Plasmid#118154PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationSee depositor comments belowPromoterEF1a core and U6Available SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pyEvolvR (enCas9-PolI5M)
Plasmid#158073PurposeExpresses enCas9 fused to PolI5M in S. cerevisiae; contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI5M
ExpressionBacterial and YeastAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A iRFP670 P2A puro
Plasmid#122182PurposeThe plasmid codes for a Flag-spCas9 protein, a iRFP670 fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-U6
Plasmid#120358PurposepiggyBac transposon vector for sgRNA expression.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonExpressionMammalianPromoterU6Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131A
Plasmid#69273PurposeGolden Gate entry vector; 1st gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B
Plasmid#69282PurposeGolden Gate entry vector; 2nd gRNA under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131B
Plasmid#69281PurposeGolden Gate entry vector; 1st gRNA under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132A
Plasmid#69274PurposeGolden Gate entry vector; 2nd gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHelper_AcCAST
Plasmid#127923PurposeExpresses AcCAST and a crRNA targeting PSP1DepositorInsertAcTnsB, AcTnsC, AcTniQ, AcCas12k
Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133A
Plasmid#69275PurposeGolden Gate entry vector; 3rd gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAK-EL-03
Plasmid#125762PurposeEndlinker for tRNA-gRNA system when using only three guidesDepositorInsertEndlinker
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK-EL-02
Plasmid#125761PurposeEndlinker for tRNA-gRNA system when using only two guidesDepositorInsertEndlinker
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only
