We narrowed to 170,787 results for: Gene
-
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEMT-Mef2c-tPT2A-GFP
Plasmid#111771PurposeBicistronic construct: Co-express two genes by 2A peptidesDepositorAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.27kb-EGFP
Plasmid#153185PurposeTruncated mouse gamma-synuclein (mSncg-0.27kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLgw RFC1-V5-EcoDam
Plasmid#59205PurposeMammalian DamID lentiviral vector for fusing gene of interest with Dam-V5 using Gateway cloningDepositorTypeEmpty backboneUseLentiviral; DamidTagsDam (DNA adenine methyltransferase) and V5ExpressionMammalianPromoterHeat Shock Minimal PromoterAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSPORT1[attB/Ins1/NbT promoter/glGFP/bglobin 3'-UTR/Ins2]
Plasmid#74102Purposeplasmid driven under neuronal beta-tubulin promoter, bearing attB and two insulator sequences (opposite directions pointing inward towards the reporter gene)DepositorInsertsXenopus laevis beta-tubulin gene promoter region and 5'UTR
Green Lantern Green Fluorescent Protein
Rabbit beta 1-globin gene 3'UTR
ExpressionBacterialAvailable SinceMay 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6
Plasmid#64220PurposeExpression vector for sgRNA and Cas9 linked via T2A to BFP linked to the Ad4 E4orf6 gene via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E4orf6ExpressionMammalianPromoterCBh and U6Available SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYTRW22K_7Ti1
Plasmid#177293Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pY31
Plasmid#84746PurposeExpresses huLbCpf1-P2A-puro and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseCRISPRTags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B3
Plasmid#103004Purposenon-standard AAV2 rep-AAV-PHP.B3 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B3 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B2
Plasmid#103003Purposenon-standard AAV2 rep-AAV-PHP.B2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B2 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYTRW09K_0T5
Plasmid#177281Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with TcRDepositorInsertPtet-tetA(C)
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dCas9-3xNLS-VP64 (Construct 1)
Plasmid#55195PurposeExpresses taCas9 in Mammalian cells for transactivating endogenous and synthetic promoters. The backbone is a lentiviral vector.DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTagsVP64ExpressionMammalianPromoterCMV/hUBCAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYTRW26K_1Ti1
Plasmid#177292Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and eYFPDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pY003 (pFnCpf1_delta Cas)
Plasmid#69974PurposeExpresses FnCpf1 and spacers 1-4 of CRISPR array. Cas genes are removed.DepositorInsertFnCpf1 locus without Cas genes
UseCRISPRExpressionBacterialMutationCas genes are deleted from locusAvailable SinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCPP5912
Plasmid#128703PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) and chaperone Gateway donor cloneDepositorInsertshcE-avrE1
ExpressionBacterialMutationThree synonymous mutations Ala 362 (GCT-GCC), Ala…Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
gRNA-10Xcapture-PuroR
Plasmid#211496PurposePlasmid for the expression of SAM-compatible gRNA for CRISPRa with capturer sequence for 10X Genomics sequencingDepositorInsertsU6-gRNA
Ef1a-PuroR
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterEF1a and U6Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins2
Plasmid#195039PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
natMX6-ins5
Plasmid#195042PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2_LPT1
Plasmid#176253PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene and one spacer targeting the LPAAT geneDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSyn1-EGFP
Plasmid#153187PurposeMouse synapsin-1 (mSyn1) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLex_Cas9
Plasmid#117987PurposepLex_Cas9 is a single insert lentiviral vector expressing Cas9 driven by CMV promoter.DepositorInsertCas9-P2A-NLS-BASTR
UseLentiviralTagsP2A linker, nuclear localization signal and blast…Available SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCol1a1-frt (FVB)
Plasmid#63575PurposeTargeting vector for the Col1a1 locus that contains a Neo resistance cassette flanked by FRT sites, followed by an ATG-less Hygromycine resistance gene. The homology arms match the sequence of FVB.DepositorInsertCol1A-frt-hygro-pA
UseMouse Targeting; Frt/flpeExpressionBacterial and MammalianPromoterNoneAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSHUT4-eYFP
Plasmid#133094PurposeAgrobacterium T-DNA overexpression cassette comprising constitutive TEF-1alpha fused to reporter eYFP. Integrates near beta-tubulin gene in F. solani genome. Replace eYFP w/ XhoI BamHIDepositorInsertenhanced yellow flourescent protein
UseFungal expressionPromoterTEF-1αAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB137 - pL2_pSB90_pNOS::rLUC-I::tNOS_tOCS::fLUC-I::pSTR1
Plasmid#123194Purposebinary plant vector for transient dual luciferase (rLUC & fLUC with introns) expressionDepositorInsertpNOS::rLUC-I::tNOS tOCS::fLUC-I::pSTR1
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRP1MX6-ins4
Plasmid#195041PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertTRP1
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dMFot
Plasmid#44558DepositorInsertsPTETREG promoter
rtetR-M2::FFF
UseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationCompared to rtTA, rtTA-M2 has S12G, E19G, A56P, D…PromoterPTETREGAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTN6kwh
Plasmid#44724DepositorInsertspCMV-D2i promoter
htetR::NLS
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins6
Plasmid#195043PurposepFA6a derived selection cassette 5' flanked with tDEG1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
his3MX6-ins3
Plasmid#195040PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertHis5+
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLD-CAG-DYSF-CFL
Plasmid#131457PurposeEncodes Dysferlin protein (Therapeutic gene) along with Follistatin protein to cure LGMD2B along with luciferase enzyme for in vivo live imagingDepositorExpressionBacterial and MammalianMutationR15C (in DYSF) and Q2579H (in CFL)Available SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TGt
Plasmid#44508DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB65 - pL0_tGFP-I (CDS1)
Plasmid#123182PurposeGolden Gate (MoClo; CDS1) compatible turbo GFP gene from P. plumata with an intron for transient and stable expression in plants (moved to a CDS1 position from pICSL50016; Engler et al., 2014)DepositorInsertturboGFP codon-optimised for plants (P. plumata) with intron, U5 small nuclear ribonucleoprotein component (A. thaliana)
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sites; codon-optimised for plantsAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.66kb-EGFP
Plasmid#153165PurposeTruncated mouse gamma-synuclein (mSncg-0.66kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-T1TCbt
Plasmid#44514DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1TCbt
Plasmid#44515DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-1.03kb-EGFP
Plasmid#153164PurposeTruncated mouse gamma-synuclein (mSncg-1.03kb) promoter-mediates gene expression in mammalian retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
SL537
Plasmid#49945PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL536
Plasmid#49942PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL534
Plasmid#49940PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only