We narrowed to 1,606 results for: sgrna vector
-
Plasmid#221432PurposeLentiviral CRISPR/Cas9 vector for co-expression of sgRNAs and Cas9 protein.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pLKO5d.EFS.SpCas9.P2A.PAC
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHL-H1-ccdB-mEF1a-RiH
Plasmid#60601PurposeCloning vector for CRISPR-sgRNA (into the BamHI-EcoRI site), expresses RFP and hygromycin resistance gene.DepositorInsertsRed Fluorescent Protein
Hygromycin resistance gene
UseCRISPRExpressionMammalianAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-CUG
Plasmid#104183PurposeLentiviral transfer vector that carries U6-driven sgRNA targeting CUG repeats using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-CUGsgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa1-Cas9-GFP
Plasmid#208049PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa1DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.VSVg_NGFR
Plasmid#158244PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.FLAG_NGFR
Plasmid#158250PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.S.V5_mCherry-NLS
Plasmid#178211PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNuclear Localization Signal and Ollas.S.V5PromotereF1aAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.VSVg_NGFR
Plasmid#158243PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.FLAG.VSVg_NGFR
Plasmid#158245PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.FLAG.VSVg_NGFR
Plasmid#158233PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9
Plasmid#135011PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9DepositorInserthumanized S. pyogenes Cas9
Tags126aa domain from HSV-1 UL12 fused to the N-termi…ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN313 - Rad21-Halo-Frt-PGK-EM7-NeoR-bpA-Frt targeting
Plasmid#156431PurposeTargeting vector to introduce an Halotag cassette at the mouse Rad21 locus using NEOMYCINE selection. Designed for using with sgRNA CCACGGTTCCATATTATCTGDepositorAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Pou5f1
Plasmid#174872PurposeCRISPR vector for generating Pou5f1 STREAMING-tag KI cellDepositorInsertsgRNA for mouse Pou5f1 (Pou5f1 Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.NWS.VSVg_NGFR
Plasmid#158348PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.NWS.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.S_mCherry-NLS
Plasmid#178224PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.Ollas_mCherry-NLS
Plasmid#178263PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.NWS.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.HA.V5_mCherry-NLS
Plasmid#178283PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.AU1.VSVg_NGFR
Plasmid#158351PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only